Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNA12-guanine nucleotide binding protein (G protein) alpha 12 Gene
PTXBC009457
New product
Data sheet of GNA12-guanine nucleotide binding protein (G protein) alpha 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNA12-guanine nucleotide binding protein (G protein) alpha 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009457 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNA12 |
| Origin species: | Human |
| Product name: | GNA12-guanine nucleotide binding protein (G protein) alpha 12 Gene |
| Size: | 2ug |
| Accessions: | BC009457 |
| Gene id: | 2768 |
| Gene description: | guanine nucleotide binding protein (G protein) alpha 12 |
| Synonyms: | NNX3; RMP; gep; guanine nucleotide-binding protein subunit alpha-12; WUGSC:H_GS165O14.2; g alpha-12; guanine nucleotide binding protein (G protein) alpha 12; G protein subunit alpha 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgccgatgaccacgttttaaaggagaaagagagctcctggtggggccctcggggtggtctcaggtcccatttgcagtctgcaacagtgacgcgcagcccggtccggagcgtggtgagctttgtttgccttctgggtcagctttcgctgtgtctcctgtgtgtgttagaatccagagcccagaggaagtgcaagcgggtcctccgccaacggggagagcctcttcgcggcgctgttggcgacagcagcgctgtgattcgcgtagcaggggagttgtttgaaacaccttcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - small nuclear ribonucleoprotein D2 polypeptide 16.5kDa - phosphatidylinositol glycan anchor biosynthesis, class P - general transcription factor IIF, polypeptide 2, 30kDa - proteasome (prosome, macropain) subunit, beta type, 10 |