Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP5J2-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 Gene
PTXBC003678
New product
Data sheet of ATP5J2-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP5J2-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003678 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5J2 |
| Origin species: | Human |
| Product name: | ATP5J2-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 Gene |
| Size: | 2ug |
| Accessions: | BC003678 |
| Gene id: | 9551 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2 |
| Synonyms: | ATP5JL; ATP synthase subunit f, mitochondrial; ATP synthase f chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit f; F1F0-type ATPase subunit f; F1Fo-ATP synthase complex Fo membrane domain f subunit; F1Fo-ATPase synthase f subunit; ATP synthase, H+ transporting, mitochondrial Fo complex subunit F2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtcagttggtgagtgtccggccccagtaccagtgaaggacaagaaacttctggaggtcaaacttctggagctgccaagctggatcttgatgcgggacttcagtcctagtggcattttcggagcgtttcaaagaggttactaccggtactacaacaagtacatcaatgtgaagaaggggagcatctcggggattaccatggtgctggcatgctacgtgctctttagctactccttttcctacaagcatctcaagcacgagcggctccgcaaataccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1 - eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa - eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa |