GPR108-G protein-coupled receptor 108 Gene

View larger

GPR108-G protein-coupled receptor 108 Gene

Reference: PTXBC007862

Condition: New product

Print

Data sheet of GPR108-G protein-coupled receptor 108 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about GPR108-G protein-coupled receptor 108 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC007862
Product type:	DNA & cDNA
Ncbi symbol:	GPR108
Origin species:	Human
Product name:	GPR108-G protein-coupled receptor 108 Gene
Size:	2ug
Accessions:	BC007862
Gene id:	56927
Gene description:	G protein-coupled receptor 108
Synonyms:	protein GPR108; LUSTR2; lung seven transmembrane receptor 2; G protein-coupled receptor 108
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggtcatctgctacgtctacttcacccgcatcatcgccatcctgctgcaggtggctgtgccctttcagtggcagtggctgtaccagctcttggtggagggctccaccctggccttcttcgtgctcacgggctacaagttccagcccacagggaacaacccgtacctgcagctgccccaggaggacgaggaggatgttcagatggagcaagtaatgacggactctgggttccgggaaggcctctccaaagtcaacaaaacagccagcgggcgggaactgttatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- zinc ribbon domain containing 1 - Huntingtin interacting protein K - TSC22 domain family, member 1 - Wilms tumor 1 associated protein

Reviews

Be the first to write your review !

Buy GPR108-G protein-coupled receptor 108 Gene now