No products
Prices are tax excluded
PTXBC009776
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC009776 |
Product type: | DNA & cDNA |
Ncbi symbol: | ING3 |
Origin species: | Human |
Product name: | ING3-inhibitor of growth family, member 3 Gene |
Size: | 2ug |
Accessions: | BC009776 |
Gene id: | 54556 |
Gene description: | inhibitor of growth family, member 3 |
Synonyms: | Eaf4; ING2; MEAF4; p47ING3; inhibitor of growth protein 3; inhibitor of growth family member 3 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggagggaagagcaaatggcatccatcaaaaaagactactataaagctttggaagatgcagatgagaaggttcagttggcaaaccagatatatgacttgcagcacttctaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - ankyrin repeat domain 26-like 1 - calcitonin-related polypeptide beta - coiled-coil domain containing 28A - natural killer cell group 7 sequence |