Cart 5 Product Products 582,81 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 €
No products
To be determined Shipping
582,81 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 582,81 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 582,81 €
View larger 
EPM2A-epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) Gene
PTXBC005286
New product
Data sheet of EPM2A-epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EPM2A-epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005286 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EPM2A |
| Origin species: | Human |
| Product name: | EPM2A-epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) Gene |
| Size: | 2ug |
| Accessions: | BC005286 |
| Gene id: | 7957 |
| Gene description: | epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) |
| Synonyms: | EPM2A, laforin glucan phosphatase; EPM2; MELF; laforin; LAFPTPase; epilepsy, progressive myoclonus type 2, Lafora disease (laforin); epilepsy, progressive myoclonus type 2A, Lafora disease (laforin); glucan phosphatase; lafora PTPase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgccccaggcggtgtgcctgctgcatgcgctgctggagaagggacacatcgtgtacgtgcactgcaacgctggggtgggccgctccaccgcggctgtctgcggctggctccagtatgtgatgggctggaatctgaggaaggtgcagtatttcctcatggccaagaggccggctgtctacattgacgaagaggccttggcccgggcacaagaagattttttccagaaatttgggaaggttcgttcttctgtgtgtagcctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) - mitogen-activated protein kinase 1 interacting protein 1-like - BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) - Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) |