Cart 9 Product Products 1 214,87 € (empty)
-
1 x NFKBIE-nuc...121,50 € -
1 x ZFYVE26-zi...121,50 € -
1 x ZNF124-zin...121,50 € -
1 x Gas8...259,07 € -
1 x SOD1-super...113,40 € -
1 x P2RX4-puri...121,50 € -
1 x RBBP4-reti...121,50 € -
1 x LYPD5-LY6/...113,40 € -
1 x FANCA-Fanc...121,50 €
No products
To be determined Shipping
1 214,87 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 214,87 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 214,87 €
Data sheet of MGC16121-hypothetical protein MGC16121 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC16121-hypothetical protein MGC16121 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007360 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC16121 |
| Origin species: | Human |
| Product name: | MGC16121-hypothetical protein MGC16121 Gene |
| Size: | 2ug |
| Accessions: | BC007360 |
| Gene id: | 84848 |
| Gene description: | hypothetical protein MGC16121 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctggaaggaagcccggtgccagccagccttcctgaaagaccaagcccgcgccatccggcttcctccagtggacgcctgcaggacccaggtgagacacggaaccggttggggacgcgagccagggatcctgaccggttgggggcggcgagcaagggatcctgacttgggggcgttgcctcccggaatccaagcggccttttgcccgggtctcccgagatgcatcgaaattgagctcgtccacacagccccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - S100 calcium binding protein A1 - S100 calcium binding protein A4 - endothelial PAS domain protein 1 - chemokine (C-X-C motif) ligand 3 |