Cart 23 Product Products 2 659,02 € (empty)
-
1 x ECHS1-enoy...121,50 € -
1 x TAF5L-TAF5...121,50 € -
1 x SPAG7-sper...113,40 € -
-
1 x LMBR1L-lim...121,50 € -
1 x FDX1L-ferr...113,40 € -
-
-
1 x FAM124B-fa...121,50 € -
1 x PITX1-pair...121,50 € -
1 x ACTL6A-act...121,50 € -
1 x CD200-CD20...121,50 € -
1 x IGFBP5-ins...121,50 € -
1 x FAM27L-fam...113,40 € -
1 x CACNG3-cal...121,50 € -
1 x MIOX-myo-i...121,50 € -
1 x MRPL45-mit...121,50 € -
1 x F7-coagula...121,50 € -
-
1 x NDUFV3-NAD...113,40 € -
1 x EDNRA-endo...121,50 € -
1 x LOC1001255...113,40 € -
No products
To be determined Shipping
2 659,02 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 23 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 659,02 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 659,02 €
Data sheet of NUPR1-nuclear protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUPR1-nuclear protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002434 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUPR1 |
| Origin species: | Human |
| Product name: | NUPR1-nuclear protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC002434 |
| Gene id: | 26471 |
| Gene description: | nuclear protein 1 |
| Synonyms: | COM1; nuclear protein 1; candidate of metastasis 1; nuclear protein, transcriptional regulator, 1; nuclear transcriptional regulator protein 1; protein p8; nuclear protein 1, transcriptional regulator |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaccttcccaccagcaaccagcgccccccagcagcccccaggcccggaggacgaggactccagcctggatgaatctgacctctatagcctggcccattcctacctcggaggtggaggccggaaaggtcgcaccaagagagaagctgctgccaacaccaaccgccccagccctggcgggcacgagaggaaactggtgaccaagctgcagaattcagagaggaagaagcgaggggcacggcgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cofilin 2 (muscle) - cytochrome b-561 - spermidine synthase - WD repeat domain 1 |