ATG12-ATG12 autophagy related 12 homolog (S. cerevisiae) Gene View larger

ATG12-ATG12 autophagy related 12 homolog (S. cerevisiae) Gene

PTXBC011033

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATG12-ATG12 autophagy related 12 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATG12-ATG12 autophagy related 12 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011033
Product type: DNA & cDNA
Ncbi symbol: ATG12
Origin species: Human
Product name: ATG12-ATG12 autophagy related 12 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011033
Gene id: 9140
Gene description: ATG12 autophagy related 12 homolog (S. cerevisiae)
Synonyms: ATG12 autophagy related 12 homolog; ubiquitin-like protein ATG12; APG12; APG12L; FBR93; HAPG12; APG12 autophagy 12-like; Apg12 (autophagy, yeast) homolog; autophagy related 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaggagccgcagtctgtgttgcagcttcctacttcaattgctgctggaggggaaggacttacggatgtctccccagaaacaaccaccccggagcccccgtcttccgctgcagtttccccgggaacagaggaacctgctggcgacaccaagaaaaaaatttatttatgtgaatcagtcctttgctccttccccagaccaagaagttggaactctctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - synuclein, gamma (breast cancer-specific protein 1)
- adaptor-related protein complex 1, sigma 1 subunit
- leucine rich repeat containing 8 family, member D
- adaptor-related protein complex 1, sigma 2 subunit

Reviews

Buy ATG12-ATG12 autophagy related 12 homolog (S. cerevisiae) Gene now

Add to cart