Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RABGAP1L-RAB GTPase activating protein 1-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RABGAP1L-RAB GTPase activating protein 1-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012094 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RABGAP1L |
| Origin species: | Human |
| Product name: | RABGAP1L-RAB GTPase activating protein 1-like Gene |
| Size: | 2ug |
| Accessions: | BC012094 |
| Gene id: | 9910 |
| Gene description: | RAB GTPase activating protein 1-like |
| Synonyms: | HHL; TBC1D18; rab GTPase-activating protein 1-like; TBC1 domain family, member 18; expressed in hematopoietic cells, heart, liver (HLL); RAB GTPase activating protein 1 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatggaagaaatctccattatggtagcctatgacgcccatgttttcagccagctgcacgatgaagacttcctcactagtctggtggccatcagcaagcccaggtctatggtaccaaccaagaagctgaagaaatatgagaaagaatatcagacaatgcgagagagtcagctgcaacaggaagacccaatggatagatacaagtttgtatatttgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - anaphase promoting complex subunit 13 - X antigen family, member 2-like - mal, T-cell differentiation protein-like - prostaglandin E synthase 3 (cytosolic) |