Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene
PTXBC003679
New product
Data sheet of ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003679 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5I |
| Origin species: | Human |
| Product name: | ATP5I-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E Gene |
| Size: | 2ug |
| Accessions: | BC003679 |
| Gene id: | 521 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E |
| Synonyms: | ATP5K; ATP synthase subunit e, mitochondrial; ATP synthase e chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E; ATPase subunit e; F1F0-ATP synthase, murine e subunit; ATP synthase, H+ transporting, mitochondrial Fo complex subunit E |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgccaccggtgcaggtctctccgctcatcaagctcggccgctactccgccctgttcctcggtgtggcctacggagccacgcgctacaattacctaaaacctcgggcagaagaggagaggaggatagcagcagaagagaagaagaagcaggatgaactgaaacggattgccagagaattggcagaagatgacagcatattaaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G - translocase of inner mitochondrial membrane 17 homolog B (yeast) - COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) - intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) |