BCHE-butyrylcholinesterase Gene

View larger

BCHE-butyrylcholinesterase Gene

Reference: PTXBC008396

Condition: New product

Print

Data sheet of BCHE-butyrylcholinesterase Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about BCHE-butyrylcholinesterase Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC008396
Product type:	DNA & cDNA
Ncbi symbol:	BCHE
Origin species:	Human
Product name:	BCHE-butyrylcholinesterase Gene
Size:	2ug
Accessions:	BC008396
Gene id:	590
Gene description:	butyrylcholinesterase
Synonyms:	CHE1; CHE2; cholinesterase; acylcholine acylhydrolase; butyrylcholine esterase; choline esterase II; cholinesterase (serum) 2; cholinesterase 1; pseudocholinesterase
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgacgaaactacgtgctcaacaatgtcgattctggacatcattttttccaaaagtcttggaaatgacaggaaatattgatgaagcagaatgggagtggaaagcaggattccatcgctggaacaattacatgatggactggaaaaatcaatttaacgattacactagcaagaaagaaagttgtgtgggtctctaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- plasminogen-like B2 - cystatin A (stefin A) - cytochrome c, somatic - ring finger protein 5

Reviews

Be the first to write your review !

Buy BCHE-butyrylcholinesterase Gene now