Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TRNT1-tRNA nucleotidyl transferase, CCA-adding, 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRNT1-tRNA nucleotidyl transferase, CCA-adding, 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005184 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRNT1 |
| Origin species: | Human |
| Product name: | TRNT1-tRNA nucleotidyl transferase, CCA-adding, 1 Gene |
| Size: | 2ug |
| Accessions: | BC005184 |
| Gene id: | 51095 |
| Gene description: | tRNA nucleotidyl transferase, CCA-adding, 1 |
| Synonyms: | CCA1; CGI-47; MtCCA; RPEM; SIFD; CCA tRNA nucleotidyltransferase 1, mitochondrial; ATP(CTP):tRNA nucleotidyltransferase; CCA-adding enzyme; mitochondrial CCA-adding tRNA-nucleotidyltransferase; mt CCA-adding enzyme; mt tRNA CCA-diphosphorylase; mt tRNA CCA-pyrophosphorylase; mt tRNA adenylyltransferase; tRNA CCA nucleotidyl transferase 1; tRNA nucleotidyl transferase, CCA-adding, 1; tRNA-nucleotidyltransferase 1, mitochondrial; tRNA nucleotidyl transferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgaggtgcctgtatcattggcacaggccagtgctgaaccgtaggtggagtaggctgtgccttctgaagcagtatctattcacaatgaagttgcagtctcccgaattccagtcacttttcacagaaggactgaagagtctgacaggtataaatgctttccatgagaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - presenilin enhancer 2 homolog (C. elegans) - eukaryotic translation initiation factor 1B - serine/threonine protein kinase MST4 - ubiquitin-conjugating enzyme E2W (putative) |