Cart 14 Product Products 1 757,99 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 € -
1 x EGR3-early...121,50 € -
1 x RP11-265F1...121,50 € -
-
1 x TPD52-tumo...113,40 € -
-
-
1 x C11orf67-c...113,40 € -
1 x CALML3-cal...113,40 € -
1 x BNIP3L-BCL...113,40 € -
1 x MYH4...259,07 € -
1 x CXCL16-che...121,50 € -
No products
To be determined Shipping
1 757,99 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 14 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 757,99 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 757,99 €
Data sheet of PLN-phospholamban Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLN-phospholamban Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005269 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLN |
| Origin species: | Human |
| Product name: | PLN-phospholamban Gene |
| Size: | 2ug |
| Accessions: | BC005269 |
| Gene id: | 5350 |
| Gene description: | phospholamban |
| Synonyms: | CMD1P; CMH18; PLB; cardiac phospholamban |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaaagtccaatacctcactcgctcagctataagaagagcctcaaccattgaaatgcctcaacaagcacgtcaaaagctacagaatctatttatcaatttctgtctcatcttaatatgtctcttgctgatctgtatcatcgtgatgcttctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neuropilin 2 - parathymosin - neuregulin 4 - claudin 15 |