Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene
PTXBC000711
New product
Data sheet of TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000711 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM8B |
| Origin species: | Human |
| Product name: | TIMM8B-translocase of inner mitochondrial membrane 8 homolog B (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC000711 |
| Gene id: | 26521 |
| Gene description: | translocase of inner mitochondrial membrane 8 homolog B (yeast) |
| Synonyms: | DDP2; TIM8B; mitochondrial import inner membrane translocase subunit Tim8 B; DDP-like protein; deafness dystonia protein 2; translocase of inner mitochondrial membrane 8 homolog B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagttatgttgggataaatgtgtggagaagccagggaatcgcctagactctcgcactgaaaattgtctctccagctgtgtagaccgcttcattgacaccactcttgccatcaccagtcggtttgcccagattgtacagaaaggagggcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of inner mitochondrial membrane 8 homolog A (yeast) - translocase of inner mitochondrial membrane 8 homolog A (yeast) - eukaryotic translation initiation factor 4E binding protein 1 - interleukin 2 receptor, gamma (severe combined immunodeficiency) |