Cart 5 Product Products 584,17 € (empty)
-
1 x SNX32-sort...121,50 € -
-
1 x C5orf30-ch...113,40 € -
1 x ASS1-argin...121,50 € -
1 x RBMY1A1-RN...121,50 €
No products
To be determined Shipping
584,17 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 584,17 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 584,17 €
View larger 
SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene
PTXBC034384
New product
Data sheet of SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC034384 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC22A11 |
| Origin species: | Human |
| Product name: | SLC22A11-solute carrier family 22 (organic anion/urate transporter), member 11 Gene |
| Size: | 2ug |
| Accessions: | BC034384 |
| Gene id: | 55867 |
| Gene description: | solute carrier family 22 (organic anion/urate transporter), member 11 |
| Synonyms: | OAT4; hOAT4; solute carrier family 22 member 11; organic anion transporter 4; solute carrier family 22 (organic anion/cation transporter), member 11; solute carrier family 22 (organic anion/urate transporter), member 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgttctcgaagctcttggagcaagccggaggcgtgggcctcttccagaccctgcaggtgctcaccttcatcctcccctgcctcatgataccttcccagatgctcctggagaacttctcagccgccatcccaggccaccgatgctggacacacatgctggacaatggctctgcggtttccacaaacatgacccccaaggcccttctgaccatctccatcccgccaggccccaaccaggggccccaccagtgccgccgcttccgccagccacagtggcagctcttggaccccaatgccacggccaccagctggagcgaagctgacacggagccgtgtgtggacggctgggtctatgaccgcagcgtcttcacctccaccatcgtggccaagtgggacctggtgtgcagctcccagggcttgaagcccctaagccagtccatcttcatgtccgggatcctggtgggctcctttatctggggcctcctctcctaccggtttgggaggaagccgatgctgagctggtgctgcctgcagttggccgtggcgggcaccagcaccatcttcgccccaacattcgtcatctactgcggcctgcggttcgtggccgcttttgggatggccggcatctttctgagttcactgacactgatggtggagtggaccacgaccagcaggagggcggtcaccatgacggtggtgggatgtgccttcagcgcaggccaggcggcgctgggcggcctggcctttgccctgcgggactggaggactctccagctggcagcatcagtgcccttctttgccatctccctgatatcctggtggctgccagaatccgcccggtggctgattattaagggcaaaccagaccaagcacttcaggagctcagaaaggtggccaggataaatggccacaaggaggccaagaacctgaccatagaggtgctgatgtccagcgtgaaggaggaggtggcctctgcaaaggagccgcggtcggtgctggacctgttctgcgtgcccgtgctccgctggaggagctgcgccatgctggtggtgaatttctctctattgatctcctactatgggctggtcttcgacctgcagagcctgggccgtgacatcttcctcctccaggccctcttcggggccgtggacttcctgggccgggccaccactgccctcttgctcagtttccttggccgccgcaccatccaggcgggttcccaggccatggccggcctcgccattctagccaacatgctggtgccgcaagatttgcagaccctgcgtgtggtctttgctgtgctgggaaagggatgttttgggataagcctaacctgcctcaccatctacaaggctgaactctttccaacgccagtgcggatgacagcagatggcattctgcatacagtgggccggctgggggctatgatgggtcccctgatcctgatgagccgccaagccctgcccctgctgcctcctctcctctatggcgttatctccattgcttccagcctggttgtgctgttcttcctcccggagacccagggacttccgctccctgacactatccaggacctggagagccagaaatcaacagcagcccagggcaaccggcaagaggccgtcactgtggaaagtacctcgctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) - protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform - glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast) - E74-like factor 3 (ets domain transcription factor, epithelial-specific ) |