Cart 117 Product Products 14 620,76 € (empty)
-
1 x TSSK3-test...121,50 € -
1 x CD70-CD70...113,40 € -
1 x LOC400590-...113,40 € -
-
-
1 x PHF11-PHD...121,50 € -
1 x B3GNT5-UDP...121,50 € -
1 x VSTM2A-V-s...113,40 € -
1 x LOC148413-...113,40 € -
1 x KCNS2-pota...121,50 € -
1 x MAGEB4-mel...121,50 € -
1 x SGCZ-sarco...113,40 € -
-
-
-
-
1 x LOC541471-...113,40 € -
1 x KLK2-kalli...113,40 € -
1 x FCRLA-Fc...121,50 € -
1 x RNF8-ring...121,50 € -
1 x HOXA6-home...113,40 € -
1 x LOC151300-...113,40 € -
-
-
1 x PDPK1-3-ph...121,50 € -
1 x LAMA4-lami...113,40 € -
1 x C10orf97-c...113,40 € -
-
1 x CSNK1G1-ca...121,50 € -
1 x SRD5A1-ste...113,40 € -
1 x PPP2R2B-pr...121,50 € -
1 x GNG7-guani...113,40 € -
-
1 x ADAT2-aden...113,40 € -
1 x SH3BGR-SH3...113,40 € -
1 x SLC25A45-s...113,40 € -
1 x ZMAT2-zinc...113,40 € -
1 x ADH1C-alco...121,50 € -
-
-
1 x C18orf56-c...113,40 € -
1 x C1orf51-ch...121,50 € -
1 x ZNF695-zin...113,40 € -
1 x HSN2-hered...121,50 € -
-
-
1 x MIS12-MIS1...113,40 € -
1 x MS4A1-memb...121,50 € -
1 x LRRN4-leuc...121,50 € -
1 x TIMM23-tra...113,40 € -
1 x PPP1CA-pro...121,50 € -
1 x NHLRC2-NHL...121,50 € -
1 x SMCHD1-str...121,50 € -
-
-
-
1 x RFPL4A...259,07 € -
-
-
-
-
1 x FAM158A-fa...113,40 € -
1 x RAC1-ras-r...113,40 € -
1 x FLJ44006-h...113,40 € -
-
-
-
1 x ITM2A-inte...113,40 € -
1 x ESRRA-estr...121,50 € -
-
-
1 x C15orf32-c...113,40 € -
1 x Olfactory...259,07 € -
-
-
1 x MGC3207-tr...121,50 € -
1 x SLC38A7-so...121,50 € -
1 x KRTAP4-12-...113,40 € -
1 x SC5DL-ster...121,50 € -
1 x TRAM2-tran...121,50 € -
-
1 x NPM1-nucle...113,40 € -
-
-
1 x SPANXB2-SP...113,40 € -
1 x CHMP5-chro...113,40 € -
1 x PRKAR2B-pr...121,50 € -
1 x HSF2-heat...113,40 € -
1 x MXRA7-matr...113,40 € -
-
1 x RANGRF-RAN...113,40 € -
1 x NARG1L-NMD...121,50 € -
1 x KCMF1-pota...121,50 € -
1 x PABPCP2-po...121,50 € -
1 x NHP2L1-NHP...113,40 € -
1 x CRYBA1-cry...113,40 € -
1 x UCP1-uncou...121,50 € -
-
1 x BOLA2-bolA...113,40 € -
1 x INSL3-insu...113,40 € -
1 x PNMA5-para...121,50 € -
-
1 x LPCAT1-lys...121,50 € -
1 x BCL2L13-BC...121,50 € -
1 x RPA4-repli...113,40 € -
-
-
1 x AKR1C3-ald...121,50 € -
1 x MyoD...259,07 € -
1 x SH2B1-SH2B...121,50 € -
1 x TSSK6-test...121,50 € -
1 x GPN2-GPN-l...121,50 € -
-
1 x NIPSNAP3B-...113,40 € -
1 x PLA2G15-ph...121,50 € -
1 x CAMK2D-cal...121,50 € -
1 x MRPL49-mit...113,40 €
No products
To be determined Shipping
14 620,76 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 117 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 14 620,76 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 14 620,76 €
View larger 
Data sheet of ALPP-alkaline phosphatase, placental (Regan isozyme) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALPP-alkaline phosphatase, placental (Regan isozyme) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC009647 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALPP |
| Origin species: | Human |
| Product name: | ALPP-alkaline phosphatase, placental (Regan isozyme) Gene |
| Size: | 2ug |
| Accessions: | BC009647 |
| Gene id: | 250 |
| Gene description: | alkaline phosphatase, placental (Regan isozyme) |
| Synonyms: | ALP; PALP; PLAP; PLAP-1; alkaline phosphatase, placental type; alkaline phosphatase Regan isozyme; alkaline phosphomonoesterase; glycerophosphatase; placental alkaline phosphatase 1; alkaline phosphatase, placental |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggggccctgcatgctgctgctgctgctgctgctgggcctgaggctacagctctccctgggcatcatcccagttgaggaggagaacccggacttctggaaccgcgaggcagccgaggccctgggtgccgccaagaagctgcagcctgcacagacagccgccaagaacctcatcatcttcctgggcgatgggatgggggtgtctacggtgacagctgccaggatcctaaaagggcagaagaaggacaaactggggcctgagttacccctggccatggaccgcttcccatatgtggctctgtccaagacatacaatgtagacaaacatgtgccagacagtggagccacagccacggcctacctgtgcggggtcaagggcaacttccagaccattggcttgagtgcagccgcccgctttaaccagtgcaacacgacacgcggcaacgaggtcatctccgtgatgaatcgggccaagaaagcagggaagtcagtgggagtggtaaccaccacacgagtgcagcacgcctcgccagccggcacctacgcccacacggtgaaccgcaactggtactcggacgccgacgtgcctgcctcggcccgccaggaggggtgccaggacatcgctacgcagctcatctccaacatggacattgacgtgatcctaggtggaggccgaaagtacatgtttcgcatgggaaccccagaccctgagtacccagatgactacagccaaggtgggaccaggctggacgggaagaatctggtgcaggaatggctggcgaagcgccagggtgcccggtacgtgtggaaccgcactgagctcatgcaggcttccctggacccgtctgtgacccatctcatgggtctctttgagcctggagacatgaaatacgagatccaccgagactccacactggacccctccctgatggagatgacagaggctgccctgcgcctgctgagcaggaacccccgcggcttcttcctcttcgtggagggtggtcgcatcgaccatggtcatcatgaaagcagggcttaccgggcactgactgagacgatcatgttcgacgacgccattgagagggcgggccagctcaccagcgaggaggacacgctgagcctcgtcactgccgaccactcccacgtcttctccttcggaggctaccccctgcgagggagctccatcttcgggctggcccctggcaaggcccgggacaggaaggcctacacggtcctcctatacggaaacggtccaggctatgtgctcaaggacggcgcccggccggatgttaccgagagcgagagcgggagccccgagtatcggcagcagtcagcagtgcccctggacgaagagacccacgcaggcgaggacgtggcggtgttcgcgcgcggcccgcaggcgcacctggttcacggcgtgcaggagcagaccttcatagcgcacgtcatggccttcgccgcctgcctggagccctacaccgcctgcgacctggcgccccccgccggcaccaccgacgccgcgcacccggggcggtccgtggtccccgcgttgcttcctctgctggccgggaccctgctgctgctggagacggccactgctccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - acyl-Coenzyme A dehydrogenase family, member 9 - dihydrouridine synthase 3-like (S. cerevisiae) - GABA(A) receptor-associated protein like 1 - erythrocyte membrane protein band 4.1-like 3 |