Cart 2 Product Products 224,28 € (empty)
-
1 x IMPACT-Imp...121,50 € -
No products
To be determined Shipping
224,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 224,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 224,28 €
View larger 
Data sheet of DNAJA2-DnaJ (Hsp40) homolog, subfamily A, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DNAJA2-DnaJ (Hsp40) homolog, subfamily A, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013044 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DNAJA2 |
| Origin species: | Human |
| Product name: | DNAJA2-DnaJ (Hsp40) homolog, subfamily A, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC013044 |
| Gene id: | 10294 |
| Gene description: | DnaJ (Hsp40) homolog, subfamily A, member 2 |
| Synonyms: | CPR3; DJ3; DJA2; DNAJ; DNJ3; HIRIP4; PRO3015; RDJ2; dnaJ homolog subfamily A member 2; DnaJ (Hsp40) homolog, subfamily A, member 2; HIRA interacting protein 4; cell cycle progression 3 protein; cell cycle progression restoration gene 3 protein; renal carcinoma antigen NY-REN-14; DnaJ heat shock protein family (Hsp40) member A2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctaacgtggctgacacgaagctgtacgacatcctgggcgtcccgcccggcgccagcgagaacgagctgaagaaggcatacagaaagttagccaaggaatatcatcctgataagaatccaaatgcaggagacaaatttaaagaaataagttttgcatatgaagtactatcaaatcctgagaagcgtgagttatatgacagatacggagagcaaggtcttcgggaaggcagcggcggaggtggtggcatggatgatattttctctcacatttttggtgggggattgttcggcttcatgggcaatcagagtagaagtcgaaatggcagaagaagaggagaggacatgatgcatccactcaaagtatctttagaagatctgtataatggcaagacaaccaaactacaacttagcaagaatgtgctctgtagtgcatgcagtggccaaggcggaaagtctggagctgtccaaaagtgtagtgcttgtcgaggtcgaggtgtgcgcatcatgatcagacagctggctccagggatggtacaacagatgcagtctgtgtgctctgattgtaatggagaaggagaggtaattaatgaaaaagaccgctgtaaaaaatgtgaagggaagaaggtgattaaagaagtcaagattcttgaagtccacgtagacaaaggcatgaaacatggacagagaattacattcactggggaagcagaccaggccccaggagtggaacccggagacattgttcttttgctacaggagaaagaacatgaggtatttcagagagatgggaatgatttgcacatgacatataaaataggacttgttgaagctctatgtggatttcagttcacatttaagcaccttgatggacgtcagattgtggtgaaatacccccctggcaaagtaattgaaccagggtgtgttcgtgtagttcgaggtgaagggatgccgcagtatcgtaatccctttgaaaaaggtgatctttacataaagtttgatgtgcagtttcctgaaaacaactggatcaacccagacaagctttctgaactagaagatcttctgccatctagaccggaagttcctaacataattggagaaacagaggaggtagagcttcaggaatttgatagcactcgaggctcaggaggtggtcagaggcgtgaagcctataatgatagctctgatgaagaaagcagcagccatcatggacctggagtgcagtgtgcccatcagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - interferon-related developmental regulator 2 - aldehyde dehydrogenase 3 family, member B1 - methyl CpG binding protein 2 (Rett syndrome) - aldehyde dehydrogenase 1 family, member A1 |