Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene
PTXBC004386
New product
Data sheet of EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004386 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF4A3 |
| Origin species: | Human |
| Product name: | EIF4A3-eukaryotic translation initiation factor 4A, isoform 3 Gene |
| Size: | 2ug |
| Accessions: | BC004386 |
| Gene id: | 9775 |
| Gene description: | eukaryotic translation initiation factor 4A, isoform 3 |
| Synonyms: | DDX48; MUK34; NMP265; NUK34; RCPS; eIF4AIII; eukaryotic initiation factor 4A-III; ATP-dependent RNA helicase DDX48; ATP-dependent RNA helicase eIF4A-3; DEAD (Asp-Glu-Ala-Asp) box polypeptide 48; DEAD box protein 48; NMP 265; eIF-4A-III; eIF4A-III; eukaryotic initiation factor 4A-like NUK-34; eukaryotic translation initiation factor 4A; hNMP 265; nuclear matrix protein 265; eukaryotic translation initiation factor 4A3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaccacggccacgatggcgacctcgggctcggcgcgaaagcggctgctcaaagaggaagacatgactaaagtggaattcgagaccagcgaggaggtggatgtgacccccacgttcgacaccatgggcctgcgggaggacctgctgcggggcatctacgcttacggttttgaaaaaccatcagcaatccagcaacgagcaatcaagcagatcatcaaagggagagatgtcatcgcacagtctcagtccggcacaggaaaaacagccaccttcagtatctcagtcctccagtgtttggatattcaggttcgtgaaactcaagctttgatcttggctcccacaagagagttggctgtgcagatccagaaggggctgcttgctctcggtgactacatgaatgtccagtgccatgcctgcattggaggcaccaatgttggcgaggacatcaggaagctggattacggacagcatgttgtcgcgggcactccagggcgtgtttttgatatgattcgtcgcagaagcctaaggacacgtgctatcaaaatgttggttttggatgaagctgatgaaatgttgaataaaggtttcaaagagcagatttacgatgtatacaggtacctgcctccagccacacaggtggttctcatcagtgccacgctgccacacgagattctggagatgaccaacaagttcatgaccgacccaatccgcatcttggtgaaacgtgatgaattgactctggaaggcatcaagcaatttttcgtggcagtggagagggaagagtggaaatttgacactctgtgtgacctctacgacacactgaccatcactcaggcggtcatcttctgcaacaccaaaagaaaggtggactggctgacggagaaaatgagggaagccaacttcactgtatcctcaatgcatggagacatgccccagaaagagcgggagtccatcatgaaggagttccggtcgggcgccagccgagtgcttatttctacagatgtctgggccagggggttggatgtccctcaggtgtccctcatcattaactatgatctccctaataacagagaattgtacatacacagaattgggagatcaggtcgatacggccggaagggtgtggccattaactttgtaaagaatgacgacatccgcatcctcagagatatcgagcagtactattccactcagattgatgagatgccgatgaacgttgctgatcttatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 4A, isoform 3 - phosphatidylinositol glycan anchor biosynthesis, class O - general transcription factor IIF, polypeptide 1, 74kDa - catenin (cadherin-associated protein), alpha 1, 102kDa |