Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene
PTXBC000699
New product
Data sheet of KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000699 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNQ2 |
| Origin species: | Human |
| Product name: | KCNQ2-potassium voltage-gated channel, KQT-like subfamily, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC000699 |
| Gene id: | 3785 |
| Gene description: | potassium voltage-gated channel, KQT-like subfamily, member 2 |
| Synonyms: | BFNC; EBN; EBN1; ENB1; HNSPC; KCNA11; KV7.2; potassium voltage-gated channel subfamily KQT member 2; neuroblastoma-specific potassium channel subunit alpha KvLQT2; potassium channel, voltage gated KQT-like subfamily Q, member 2; voltage-gated potassium channel subunit Kv7.2; potassium voltage-gated channel subfamily Q member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgcagaagtcgcgcaacggcggcgtataccccggcccgagcggggagaagaagctgaaggtgggcttcgtggggctggaccccggcgcgcccgactccacccgggacggggcgctgctgatcgccggctccgaggcccccaagcgcggcagcatcctcagcaaacctcgcgcgggcggcgcgggcgccgggaagccccccaagcgcaacgccttctaccgcaagctgcagaatttcctctacaacgtgctggagcggccgcgcggctgggcgttcatctaccacgcctacgtgttcctcctggttttctcctgcctcgtgctgtctgtgttttccaccatcaaggagtatgagaagagctcggagggggccctctacatcctggaaatcgtgactatcgtggtgtttggcgtggagtacttcgtgcggatctgggccgcaggctgctgctgccggtaccgtggctggagggggcggctcaagtttgcccggaaaccgttctgtgtgattgacatcatggtgctcatcgcctccattgcggtgctggccgccggctcccagggcaacgtctttgccacatctgcgctccggagcctgcgcttcctgcagattctgcggatgatccgcatggaccggcggggaggcacctggaagctgctgggctctgtggtctatgcccacagcaaggagctggtcactgcctggtacatcggcttcctttgtctcatcctggcctcgttcctggtgtacttggcagagaagggggagaacgaccactttgacacctacgcggatgcactctggtggggcctgatcacgctgaccaccattggctacggggacaagtacccccagacctggaacggcaggctccttgcggcaaccttcaccctcatcggtgtctccttcttcgcgctgcctgcaggcatcttggggtctgggtttgccctgaaggttcaggagcagcacaggcagaagcactttgagaagaggcggaacccggcagcaggcctgatccagtcggcctggagattctacgccaccaacctctcgcgcacagacctgcactccacgtggcagtactacgagcgaacggtcaccgtgcccatgtacaggtaccgccgccgggcacctgccaccaagcaactgtttcattttttattttccatttgttcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of outer mitochondrial membrane 6 homolog (yeast) - formation of mitochondrial complexes 1 homolog (S. cerevisiae) - NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) - mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) |