Cart 8 Product Products 904,68 € (empty)
-
1 x HIST1H3A-h...113,40 € -
1 x C9orf9-chr...113,40 € -
1 x SNRPN-smal...113,40 € -
1 x RWDD4A-RWD...113,40 € -
-
1 x TP53I3-tum...121,50 € -
1 x SSX3-synov...113,40 € -
1 x FAM150A-fa...113,40 €
No products
To be determined Shipping
904,68 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 904,68 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 904,68 €
Data sheet of TPST2-tyrosylprotein sulfotransferase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TPST2-tyrosylprotein sulfotransferase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001057 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TPST2 |
| Origin species: | Human |
| Product name: | TPST2-tyrosylprotein sulfotransferase 2 Gene |
| Size: | 2ug |
| Accessions: | BC001057 |
| Gene id: | 8459 |
| Gene description: | tyrosylprotein sulfotransferase 2 |
| Synonyms: | TANGO13B; protein-tyrosine sulfotransferase 2; TPST-2; transport and golgi organization 13 homolog B; tyrosylprotein phosphotransferase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgcctgtcggtgcggagggtgctgctggcagccggctgcgccctggtcctggtgctggcggttcagctgggacagcaggtgctagagtgccgggcggtgctggcgggcctgcggagcccccggggggccatgcggcctgagcaggaggagctggtgatggtgggcaccaaccacgtggaataccgctatggcaaggccatgccgctcatcttcgtgggtggcgtgcctcgcagtggcaccacgttgatgcgcgccatgctggacgcgcaccccgaggtgcgctgcggcgaggagacccgcatcatcccgcgcgtgctggccatgcgccaggcctggtccaagtctggccgtgagaagctgcggctggatgaggcgggggtgacggatgaggtgctggacgccgccatgcaggccttcatcctggaggtgattgccaagcacggagagccggcccgcgtgctctgcaacaaggacccatttacgctcaagtcctcggtctacctgtcgcgcctgttccccaactccaagttcctgctgatggtgcgggacggccgggcctccgtgcactccatgatcacgcgcaaagtcaccattgcgggctttgacctcagcagctaccgtgactgcctcaccaagtggaacaaggccatcgaggtgatgtacgcccagtgcatggaggtaggcaaggagaagtgcctgcctgtgtactacgagcagctggtgctgcaccccaggcgctcactcaagctcatcctcgacttcctcggcatcgcctggagcgacgctgtcctccaccatgaagacctcattggcaagcccggtggtgtctccctgtccaagatcgagcggtccacggaccaggtcatcaagcctgttaacctggaagcgctctccaagtggactggccacatccctggggatgtggtgcgggacatggcccagatcgcccccatgctggctcagctcggctatgacccttatgcaaacccccccaactatggcaaccctgaccccttcgtcatcaacaacacacagcgggtcttgaaaggggactataaaacaccagccaatctgaaaggatattttcaggtgaaccagaacagcacctcctcccacttaggaagctcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tyrosylprotein sulfotransferase 2 - coiled-coil domain containing 51 - LAG1 homolog, ceramide synthase 2 - LAG1 homolog, ceramide synthase 2 |