Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GRINL1A-glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A Gene
PTXBC001510
New product
Data sheet of GRINL1A-glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GRINL1A-glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001510 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GRINL1A |
| Origin species: | Human |
| Product name: | GRINL1A-glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A Gene |
| Size: | 2ug |
| Accessions: | BC001510 |
| Gene id: | 81488 |
| Gene description: | glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A |
| Synonyms: | protein GRINL1A, isoforms 4/5; GRINL1A downstream protein Gdown4; protein GRINL1A; GRINL1A; GCOM1; Gdown; Gdown1; DNA-directed RNA polymerase II subunit M, isoforms 4/5; glutamate receptor, ionotropic, N-methyl D-aspartate-like 1A; polymerase (RNA) II (DNA directed) polypeptide M; polymerase (RNA) II subunit M; RNA polymerase II subunit M |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgctcgctgccccgcggcttcgagccccaagctcccgaggacttggcgcagcggagtttggtggagctgcgggaaatgttgaagcgccaggagagacttttgcgcaacgaaaaattcatttgcaaattgcccgacaaaggtaaaaagatctttgactcttttgccaaactgaaagctgccattgcagaatgtgaagaagttagaagaaaaagtgaactgtttaaccctgttagtttagactgtaagctaaggcaaaaagcaattgcagaagttgatgtgggtacagataaggcccagaattctgacccgatacttgatacttcatcactagttcctggatgttcctctgtagataacatcaagtcatctcaaacctcacaaaaccagggacttggacgtcctactcttgaaggtgatgaagagacttcagaggttgagtacacagtgaataagggcccagcttccagcaatagagacagggtaccaccttcatctgaagctagtgagcatcacccgcggcatcgtgtttcaagtcaagcggaagatacttccagcagctttgacaacctgtttattgacaggttacagaggatcaccattgcggaccaaggtgaacaacagtcagaagaaaacgcaagtactaagaacttgacaggcctttccagtgggactgagaagaaacctcattacatggaagtgctagaaatgcgagccaaaaacccagtgccccagctgcgtaaatttaaaaccaatgtgttaccttttcgacaaaatgattcatctagtcattgccagaagagtgggtctcctatttcctcagaagagcggcggcgcagggataagcagcatcttgatgacatcacagcagctcggcttctaccacttcaccatatgcccacgcagctgctctccatagaagaatccttggcacttcagaaacagcagaaacagaattatgaggagatgcaagcaaagctcgcagcgcaaaaattagctgaaagactgaatattaaaatgcggagttataatccagaaggggagtcttcagggagataccgagaagtaagggatgaagatgacgattggtcctctgatgaattctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serum deprivation response (phosphatidylserine binding protein) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa - general transcription factor IIIC, polypeptide 6, alpha 35kDa - KRR1, small subunit (SSU) processome component, homolog (yeast) |