Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of A4GALT-alpha 1,4-galactosyltransferase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about A4GALT-alpha 1,4-galactosyltransferase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017068 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | A4GALT |
| Origin species: | Human |
| Product name: | A4GALT-alpha 1,4-galactosyltransferase Gene |
| Size: | 2ug |
| Accessions: | BC017068 |
| Gene id: | 53947 |
| Gene description: | alpha 1,4-galactosyltransferase |
| Synonyms: | A14GALT; A4GALT1; Gb3S; P1PK; lactosylceramide 4-alpha-galactosyltransferase; GB3 synthase; P blood group (P one antigen); P(k) antigen synthase; P1/Pk synthase; UDP-galactose:beta-D-galactosyl-beta1-R 4-alpha-D-galactosyltransferase; alpha 14-galactosyltransferase; alpha-1,4-N-acetylglucosaminyltransferase; alpha4Gal-T1; globotriaosylceramide synthase; truncated alpha 1,4-galactosyltransferase; alpha 1,4-galactosyltransferase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccaagccccccgacctcctgctgcggctgctccggggcgccccaaggcagcgggtctgcaccctgttcatcatcggcttcaagttcacgtttttcgtctccatcatgatctactggcacgttgtgggagagcccaaggagaaagggcagctctataacctgccagcagagatcccctgccccaccttgacaccccccaccccaccctcccacggccccactccaggcaacatcttcttcctggagacttcagaccggaccaaccccaacttcctgttcatgtgctcggtggagtcggccgccagaactcaccccgaatcccacgtgctggtcctgatgaaagggcttccgggtggcaacgcctctctgccccggcacctgggcatctcacttctgagctgcttcccgaatgtccagatgctcccgctggacctgcgggagctgttccgggacacacccctggccgactggtacgcggccgtgcaggggcgctgggagccctacctgctgcccgtgctctccgacgcctccaggatcgcactcatgtggaagttcggcggcatctacctggacacggacttcattgttctcaagaacctgcggaacctgaccaacgtgctgggcacccagtcccgctacgtcctcaacggcgcgttcctggccttcgagcgccggcacgagttcatggcgctgtgcatgcgggacttcgtggaccactacaacggctggatctggggtcaccagggcccgcagctgctcacgcgggtcttcaagaagtggtgttccatccgcagcctggccgagagccgcgcctgccgcggcgtcaccaccctgccccctgaggccttctaccccatcccctggcaggactggaagaagtactttgaggacatcaaccccgaggagctgccgcggctgctcagtgccacctatgctgtccacgtgtggaacaagaagagccagggcacgcggttcgaggccacgtccagggcactgctggcccagctgcatgcccgctactgccccacgacgcacgaggccatgaaaatgtacttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphoserine aminotransferase 1 - delta-like 1 homolog (Drosophila) - tetratricopeptide repeat domain 4 - SERPINE1 mRNA binding protein 1 |