Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V0D1-ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Gene
PTXBC008861
New product
Data sheet of ATP6V0D1-ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V0D1-ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008861 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V0D1 |
| Origin species: | Human |
| Product name: | ATP6V0D1-ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Gene |
| Size: | 2ug |
| Accessions: | BC008861 |
| Gene id: | 9114 |
| Gene description: | ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 |
| Synonyms: | ATP6D; ATP6DV; P39; VATX; VMA6; VPATPD; V-type proton ATPase subunit d 1; 32 kDa accessory protein; ATPase, H+ transporting, lysosomal (vacuolar proton pump), member D; ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1; H(+)-transporting two-sector ATPase, subunit D; V-ATPase 40 KDa accessory protein; V-ATPase AC39 subunit; V-ATPase subunit d 1; V-ATPase, subunit D; vacuolar proton pump subunit d 1; ATPase H+ transporting V0 subunit d1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgttcttcccggagctttactttaacgtggacaatggctacttggagggactggtgcgcggcctgaaggccggggtgctcagccaggccgactacctcaacctggtgcagtgcgagacgctagaggacttgaaactgcatctgcagagcactgattatggtaacttcctggccaacgaggcatcacctctgacggtgtcagtcatcgatgaccggctcaaggagaagatggtggtggagttccgccacatgaggaaccatgcctatgagccactcgccagcttcctagacttcattacttacagttacatgatcgacaacgtgatcctgctcatcacaggcacgctgcaccagcgctccatcgctgagctcgtgcccaagtgccacccactaggcagcttcgagcagatggaggccgtgaacattgctcagacacctgctgagctctacaatgccattctggtggacacgcctcttgcggcttttttccaggactgcatttcagagcaggaccttgacgagatgaacatcgagatcatccgcaacaccctctacaaggcctacctggagtccttctacaagttctgcaccctactgggcgggactacggctgatgccatgtgccccatcctggagtttgaagcagaccgccgcgccttcatcatcaccatcaattctttcggcacagagctgtccaaagaggaccgtgccaagctctttccacactgtgggcggctctaccctgagggcctggcgcagctggctcgggctgacgactatgaacaggtcaagaacgtggccgattactacccggagtacaagctgctcttcgagggtgcaggtagcaaccctggagacaagacgctggaggaccgattctttgagcacgaggtaaagctgaacaagttggccttcctgaaccagttccactttggtgtcttctatgccttcgtgaagctcaaggagcaggagtgtcgcaacatcgtgtggatcgctgaatgtatcgcccagcgccaccgcgccaaaatcgacaactacatccctatcttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 - sterile alpha motif and leucine zipper containing kinase AZK - protein C (inactivator of coagulation factors Va and VIIIa) - v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) |