Cart 28 Product Products 4 260,83 € (empty)
-
1 x RELT-RELT...121,50 € -
1 x LOC440461-...113,40 € -
-
1 x Phospho-My...259,07 € -
1 x SENP3...259,07 € -
1 x TALDO1-tra...121,50 € -
-
1 x PGK1-phosp...121,50 € -
1 x RRM2B-ribo...121,50 € -
1 x PHCA-phyto...121,50 € -
1 x RYBP-RING1...113,40 € -
1 x MxB...259,07 € -
1 x GPR15-G...121,50 € -
1 x NUTF2-nucl...113,40 € -
1 x CASP14-cas...113,40 € -
1 x SLC25A39-s...121,50 € -
-
1 x MAPK10-mit...121,50 € -
-
1 x SKP1-S-pha...113,40 € -
1 x Ribosomal...259,07 € -
1 x UBE2Z-ubiq...113,40 € -
1 x TMEM116-tr...113,40 € -
1 x TMEM55B-tr...121,50 € -
1 x FCRL1-Fc...121,50 € -
1 x UTP15-UTP1...121,50 € -
-
1 x KANK2...259,07 €
No products
To be determined Shipping
4 260,83 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 28 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 260,83 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 260,83 €
View larger 
TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene
PTXBC016452
New product
Data sheet of TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016452 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TWF2 |
| Origin species: | Human |
| Product name: | TWF2-twinfilin, actin-binding protein, homolog 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC016452 |
| Gene id: | 11344 |
| Gene description: | twinfilin, actin-binding protein, homolog 2 (Drosophila) |
| Synonyms: | A6RP; A6r; MSTP011; PTK9L; twinfilin-2; A6-related protein; PTK9L protein tyrosine kinase 9-like (A6-related protein); protein tyrosine kinase 9-like (A6-related protein); twinfilin, actin-binding protein, homolog 2; twinfilin-1-like protein; twinfilin actin binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcaccaaacgggcatccacgccacggaagagctgaaggaattctttgccaaggcacgggctggctctgtgcggctcatcaaggttgtgattgaggacgagcagctcgtgctgggtgcctcgcaggagccagtaggccgctgggatcaggactatgacagggccgtgctgccactgctggacgcccagcagccctgctacctgctctaccgcctcgactcacagaatgctcagggcttcgaatggctcttcctcgcctggtcgcctgataactcccccgtgcggctgaagatgctgtacgcggccacgcgggccacagtgaaaaaggagtttggaggtggccacatcaaggatgagctcttcgggactgtgaaggatgacctctcttttgctgggtaccagaaacacctgtcgtcctgtgcggcacctgccccgctgacctcggctgagagagagctccagcagatccgcattaacgaggtgaagacagagatcagtgtggaaagcaagcaccagaccctgcagggcctcgccttccccctgcagcctgaggcccagcgggcactccagcagctcaagcagaagatggtcaactacatccagatgaagctggacctagagcgggaaaccattgagctggtgcacacagagcccacggatgtggcccagctgccctcccgggtgccccgagatgctgcccgctaccacttcttcctctacaagcacacccatgagggcgacccccttgagtctgtagtgttcatctactccatgccggggtacaagtgcagcatcaaggagcgaatgctctactccagctgcaagagccgcctcctcgactccgtggagcaggacttccatctggagatcgccaagaaaattgagattggcgatggggcagagctgacggcagagttcctctacgacgaggtgcaccccaagcaacacgccttcaagcaggccttcgccaagcccaagggcccagggggcaagcggggccataagcgcctcatccgcggcccgggtgaaaatggggatgacagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - twinfilin, actin-binding protein, homolog 2 (Drosophila) - eukaryotic translation initiation factor 4A, isoform 3 - eukaryotic translation initiation factor 4A, isoform 3 - phosphatidylinositol glycan anchor biosynthesis, class O |