Cart 2 Product Products 234,90 € (empty)
-
1 x SUCLG2-suc...121,50 € -
1 x CUEDC2-CUE...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
Data sheet of MFGE8-milk fat globule-EGF factor 8 protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MFGE8-milk fat globule-EGF factor 8 protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003610 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MFGE8 |
| Origin species: | Human |
| Product name: | MFGE8-milk fat globule-EGF factor 8 protein Gene |
| Size: | 2ug |
| Accessions: | BC003610 |
| Gene id: | 4240 |
| Gene description: | milk fat globule-EGF factor 8 protein |
| Synonyms: | BA46; EDIL1; HMFG; HsT19888; MFG-E8; MFGM; OAcGD3S; SED1; SPAG10; hP47; lactadherin; O-acetyl disialoganglioside synthase; breast epithelial antigen BA46; medin; sperm associated antigen 10; sperm surface protein hP47; milk fat globule-EGF factor 8 protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgcgcccccgcctgctggccgcgctgtgcggcgcgctgctctgcgcccccagcctcctcgtcgccctggatatctgttccaaaaacccctgccacaacggtggtttatgcgaggagatttcccaagaagtgcgaggagatgtcttcccctcgtacacctgcacgtgccttaagggctacgcgggcaaccactgtgagacgaaatgtgtcgagccactgggcatggagaatgggaacattgccaactcacagatcgccgcctcatctgtgcgtgtgaccttcttgggtttgcagcattgggtcccggagctggcccgcctgaaccgcgcaggcatggtcaatgcctggacacccagcagcaatgacgataacccctggatccaggtgaacctgctgcggaggatgtgggtaacaggtgtggtgacgcagggtgccagccgcttggccagtcatgagtacctgaaggccttcaaggtggcctacagccttaatggacacgaattcgatttcatccatgatgttaataaaaaacacaaggagtttgtgggtaactggaacaaaaacgcggtgcatgtcaacctgtttgagacccctgtggaggctcagtacgtgagattgtaccccacgagctgccacacggcctgcactctgcgctttgagctactgggctgtgagctgaacggatgcgccaatcccctgggcctgaagaataacagcatccctgacaagcagatcacggcctccagcagctacaagacctggggcttgcatctcttcagctggaacccctcctatgcacggctggacaagcagggcaacttcaacgcctgggttgcggggagctacggtaacgatcagtggctgcagatcttccctggcaactgggacaaccactcccacaagaagaacttgtttgagacgcccatcctggctcgctatgtgcgcatcctgcctgtagcctggcacaaccgcatcgccctgcgcctggagctgctgggctgttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - butyrophilin, subfamily 2, member A2 - secretory carrier membrane protein 1 - secretory carrier membrane protein 3 - rhabdoid tumor deletion region gene 1 |