Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene
PTXBC014040
New product
Data sheet of LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014040 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LRFN4 |
| Origin species: | Human |
| Product name: | LRFN4-leucine rich repeat and fibronectin type III domain containing 4 Gene |
| Size: | 2ug |
| Accessions: | BC014040 |
| Gene id: | 78999 |
| Gene description: | leucine rich repeat and fibronectin type III domain containing 4 |
| Synonyms: | FIGLER6; SALM3; SALM3; leucine-rich repeat and fibronectin type-III domain-containing protein 4; fibronectin type III, immunoglobulin and leucine rich repeat domains 6; leucine rich repeat and fibronectin type III domain containing 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcactgggtcggtcctgacgaccggttggttggcaactcctcccgagcccgggctttccccaacgggaccttagagattggggtgaccggcgctggggacgctgggggctacacctgcatcgccaccaaccctgctggtgaggccacagcccgagtagaactgcgggtgctggccttgccccatggtgggaacagcagtgccgaggggggccgccccgggccctcggacatcgccgcctccgctcgcactgctgccgagggtgaggggacgctggagtctgagccagccgtgcaggtgacggaggtgaccgccacctcagggctggtgagctggggtcccgggcggccagccgacccagtgtggatgttccaaatccagtacaacagcagcgaagatgagaccctcatctaccggattgtcccagcctccagccaccacttcctgctgaagcacctcgtccccggcgctgactatgacctctgcctgctggccttgtcaccggccgctgggccctctgacctcacggccaccaggctgctgggctgtgcccatttctccacgctgccggcctcgcccctgtgccacgccctgcaggcccacgtgctgggcgggaccctgaccgtggccgtggggggtgtgctggtggctgccttactggtcttcactgtggccttgctggttcggggccggggggccggaaatggccgcctccccctcaagctcagccacgtccagtcccagaccaatggaggccccagccccacacccaaggcccacccgccgcggagccccccgccccggccgcagcgcagctgctctctggacctgggagatgccgggtgctacggttatgccaggcgcctgggaggagcttgggcccgacggagccactctgtgcatggggggctgctcggggcagggtgccggggggtaggaggcagcgccgagcggctggaagagagtgtggtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ARP1 actin-related protein 1 homolog B, centractin beta (yeast) - chromosome transmission fidelity factor 8 homolog (S. cerevisiae) - translocase of inner mitochondrial membrane 8 homolog B (yeast) - translocase of inner mitochondrial membrane 8 homolog A (yeast) |