Cart 3 Product Products 420,02 € (empty)
-
1 x RAB3IL1-RA...121,50 € -
1 x LIX1-Lix1...121,50 € -
No products
To be determined Shipping
420,02 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 420,02 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 420,02 €
View larger 
Data sheet of SLC22A24-solute carrier family 22, member 24 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC22A24-solute carrier family 22, member 24 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034394 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC22A24 |
| Origin species: | Human |
| Product name: | SLC22A24-solute carrier family 22, member 24 Gene |
| Size: | 2ug |
| Accessions: | BC034394 |
| Gene id: | 283238 |
| Gene description: | solute carrier family 22, member 24 |
| Synonyms: | NET46; solute carrier family 22 member 24 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggctttgatgtgctcctggatcaagtgggtggcatggggagattccagatttgtctgatagctttcttttgcatcaccaacatcctactgttccctaatattgtgttggagaacttcactgcattcacccctagtcatcgctgctgggtccccctcctggacaatgacagtgtgtctgacaatgataccgggaccctcagcaaggatgacctcctgagaatctccatcccactggactcaaacctgaggccacagaagtgtcagcgctttatccatccccagtggcagctccttcacctgaacgggaccttccccaacacaaatgagccagacacggagccctgtgtggatggctgggtgtacgacagaagctctttcctctccaccatcgtgactgagtgggacctggtatgtgaatctcagtcactaaaatcaatggttcaatccctatttatggctgggtcactgctgggaggtctaatatatggccatctttcagacagggttggacggaagatcatatgcaaattgtgtttcctccagctggccatctctaacacctgtgcggccttcgctcccaccttccttgtttactgcatactgcgcttcttggcagggttctccaccatgactattttgggaaacacttttattctcagcttagagtggacattgccccggtcacgatctatgacaataatggtgctattatgttcctacagtgttgggcagatgctcctaggagggctggcttttgccattcaggactggcacatattgcaactgactgtgtctacacccataattgtcctcttcttgtcctcttggtatgaacaatctccacattctttgcctgtaagcgaggctatggtagacatagaaaggaaaattgtgacacctgggatctgttcggtctctggcctagtcctgagccatgatgtccatagtacctattgtgtcacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BCL2-like 14 (apoptosis facilitator) - chromosome 19 open reading frame 62 - solute carrier family 25, member 39 - pyruvate dehydrogenase (lipoamide) beta |