Cart 11 Product Products 1 705,11 € (empty)
-
1 x C-Reactive...544,00 € -
1 x M6PR-manno...121,50 € -
-
1 x SPANXE-SPA...113,40 € -
1 x ARC-activi...121,50 € -
1 x SMCP-sperm...113,40 € -
-
1 x TM4SF18-tr...113,40 € -
1 x GC-group-s...121,50 € -
1 x NEU4-siali...121,50 € -
1 x TMEM31-tra...113,40 €
No products
To be determined Shipping
1 705,11 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 705,11 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 705,11 €
View larger 
NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene
PTXBC002601
New product
Data sheet of NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002601 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NFKBIA |
| Origin species: | Human |
| Product name: | NFKBIA-nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Gene |
| Size: | 2ug |
| Accessions: | BC002601 |
| Gene id: | 4792 |
| Gene description: | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha |
| Synonyms: | IKBA; MAD-3; NFKBI; NF-kappa-B inhibitor alpha; I-kappa-B-alpha; ikB-alpha; major histocompatibility complex enhancer-binding protein MAD3; nuclear factor of kappa light chain gene enhancer in B-cells; nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha; NFKB inhibitor alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttccaggcggccgagcgcccccaggagtgggccatggagggcccccgcgacgggctgaagaaggagcggctactggacgaccgccacgacagcggcctggactccatgaaagacgaggagtacgagcagatggtcaaggagctgcaggagatccgcctcgagccgcaggaggtgccgcgcggctcggagccctggaagcagcagctcaccgaggacggggactcgttcctgcacttggccatcatccatgaagaaaaggcactgaccatggaagtgatccgccaggtgaagggagacctggccttcctcaacttccagaacaacctgcagcagactccactccacttggctgtgatcaccaaccagccagaaattgctgaggcacttctgggagctggctgtgatcctgagctccgagactttcgaggaaatacccccctacaccttgcctgtgagcagggctgcctggccagcgtgggagtcctgactcagtcctgcaccaccccgcacctccactccatcctgaaggctaccaactacaatggccacacgtgtctacacttagcctctatccatggctacctgggcatcgtggagcttttggtgtccttgggtgctgatgtcaatgctcaggagccctgtaatggccggactgcccttcacctcgcagtggacctgcaaaatcctgacctggtgtcactcctgttgaagtgtggggctgatgtcaacagagttacctaccagggctattctccctaccagctcacctggggccgcccaagcacccggatacagcagcagctgggccagctgacactagaaaaccttcagatgctgccagagagtgaggatgaggagagctatgacacagagtcagagttcacggagttcacagaggacgagctgccctatgatgactgtgtgtttggaggccagcgtctgacgttatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase) - asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe) - CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 - solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 |