Cart 1 Product Products 102,78 € (empty)
No products
To be determined Shipping
102,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 102,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 102,78 €
Data sheet of RPLP0-ribosomal protein, large, P0 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPLP0-ribosomal protein, large, P0 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000345 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPLP0 |
| Origin species: | Human |
| Product name: | RPLP0-ribosomal protein, large, P0 Gene |
| Size: | 2ug |
| Accessions: | BC000345 |
| Gene id: | 6175 |
| Gene description: | ribosomal protein, large, P0 |
| Synonyms: | L10E; LP0; PRLP0; RPP0; 60S acidic ribosomal protein P0; 60S ribosomal protein L10E; acidic ribosomal phosphoprotein P0; neutral ribosomal phosphoprotein P0; ribosomal protein, large, P0; ribosomal protein lateral stalk subunit P0 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccagggaagacagggcgacctggaagtccaactacttccttaagatcatccaactattggatgattatccgaaatgtttcattgtgggagcagacaatgtgggctccaagcagatgcagcagatccgcatgtcccttcgtgggaaggctgtggtgctgatgggcaagaacaccatgatgcgcaaggccatccgagggcacctggaaaacaacccagctctggagaaactgctgcctcatatccgggggaatgtgggctttgtgttcaccaaggaggacctcactgagatcagggacatgttgctggccaataaggtgccagctgctgcccgtgctggtgccattgccccatgtgaagtcactgtgccagcccagaacactggtctcgggcccgagaagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaaatcctgagtgatgtgcagctgatcaagactggagacaaagtgggagccagcgaagccacgctgctgaacatgctcaacatctcccccttctcctttgggctggtcatccagcaggtgttcgacaatggcagcatctacaaccctgaagtgcttgatatcacagaggaaactctgcattctcgcttcctggagggtgtccgcaatgttgccagtgtctgtctgcagattggctacccaactgttgcatcagtaccccattctatcatcaacgggtacaaacgagtcctggccttgtctgtggagacggattacaccttcccacttgctgaaaaggtcaaggccttcttggctgatccatctgcctttgtggctgctgcccctgtggctgctgccaccacagctgctcctgctgctgctgcagccccagctaaggttgaagccaaggaagagtcggaggagtcggacgaggatatgggatttggtctctttgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lymphocyte-specific protein 1 - stromal cell derived factor 4 - histocompatibility (minor) 13 - FIP1 like 1 (S. cerevisiae) |