Cart 38 Product Products 5 048,40 € (empty)
-
1 x CCL20-chem...113,40 € -
1 x C12orf43-c...113,40 € -
1 x C10orf63-c...113,40 € -
1 x DPH1-DPH1...121,50 € -
1 x GSS-glutat...121,50 € -
1 x ATP6V1D-AT...113,40 € -
1 x RICH2-Rho-...113,40 € -
1 x C1orf38-ch...113,40 € -
1 x ZNF468-zin...113,40 € -
1 x NCR3-natur...113,40 € -
-
-
-
1 x KIAA0174-K...121,50 € -
1 x GSTA1-glut...113,40 € -
-
-
1 x SNHG7-smal...113,40 € -
1 x C1QBP-comp...121,50 € -
1 x LOC440456-...113,40 € -
1 x BLOC1S1-bi...113,40 € -
-
-
1 x C9orf11-ch...113,40 € -
1 x SPATA6-spe...121,50 € -
1 x RSRC1-argi...121,50 € -
1 x C14orf100-...121,50 € -
-
1 x LYPD4-LY6/...113,40 € -
-
-
-
-
-
1 x C9orf97-ch...121,50 € -
1 x NDUFS5...259,07 € -
-
No products
To be determined Shipping
5 048,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 38 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 048,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 048,40 €
View larger 
Data sheet of SCML4-sex comb on midleg-like 4 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCML4-sex comb on midleg-like 4 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033286 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCML4 |
| Origin species: | Human |
| Product name: | SCML4-sex comb on midleg-like 4 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC033286 |
| Gene id: | 256380 |
| Gene description: | sex comb on midleg-like 4 (Drosophila) |
| Synonyms: | dJ47M23.1; sex comb on midleg-like protein 4; sex comb on midleg-like 4 (Drosophila) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccctgccagagaacagcttggataggttgcgacaggcagagaacccccccattccactggagagagatcaagtctcgggttctcatgactcccttagccctctcacctccgcggagtaccccagagcccgacctcagctccatccctcaggacgcagccacggtccccagcttggcggccccacaggctctcacagtctgcctctacatcaacaagcaggccaatgcggggccctatctggagaggaagaaggtgcagcagctcccggagcattttgggcccgagcggccatcggcggtgctgcagcaggccgtccaagcctgcatcgactgcgcccaccagcagaagctggtcttctccctggtcaagcagggctatggtggtgagatggtgtcagtctcggcttcctttgatggcaaacagcacctgcggagcctgcctgtggtgaacagcatcggctatgtcctccgcttcctcgccaagctgtgccgaagcctcctgtgcgatgacctcttcagccaccagcccttccccaggggctgcagtgcctctgagaaagtccaggagaaagaggaagggaggatggaatcagtcaagacagtcaccaccgaagagtacctggtgaaccctgtgggcatgaaccgctacagcgtggacacctccgcctccacctttaaccacaggggctccttgcacccctcctcctcgctgtactgcaagaggcagaactctggagacagccaccttgggggtggtcctgctgccaccgctggtggtccccgcactagccccatgtcttctggtggcccctcggcacctgggctgaggcctccagcctccagccccaagagaaacacgacctctcttgaaggaaacagatgtggtaatgtaatgcatgcatcagcttcccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 22, member 24 - BCL2-like 14 (apoptosis facilitator) - chromosome 19 open reading frame 62 - solute carrier family 25, member 39 |