Cart 1 Product Products 102,78 € (empty)
No products
To be determined Shipping
102,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 102,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 102,78 €
Data sheet of RPSA-ribosomal protein SA Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPSA-ribosomal protein SA Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005391 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPSA |
| Origin species: | Human |
| Product name: | RPSA-ribosomal protein SA Gene |
| Size: | 2ug |
| Accessions: | BC005391 |
| Gene id: | 3921 |
| Gene description: | ribosomal protein SA |
| Synonyms: | 37LRP; 67LR; ICAS; LAMBR; LAMR1; LBP; LBP/p40; LRP; LRP/LR; NEM/1CHD4; lamR; p40; 40S ribosomal protein SA; 37 kDa laminin receptor; 37/67 kDa laminin receptor; 67 kDa laminin receptor; colon carcinoma laminin-binding protein; laminin receptor 1 (67kD, ribosomal protein SA); laminin-binding protein precursor p40; multidrug resistance-associated protein MGr1-Ag; ribosomal protein SA |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccggagcccttgatgtcctgcaaatgaaggaggaggatgtccttaagttccttgcagcaggaacccacttaggtggcaccaatcttgacttccagatggaacagtacatctataaaaggaaaagtgatggcatctatatcataaatctcaagaggacctgggagaagcttctgctggcagctcgtgcaattgttgccattgaaaaccctgctgatgtcagtgttatatcctccaggaatactggccagagggctgtgctgaagtttgctgctgccactggagccactccaattgctggccgcttcactcctggaaccttcactaaccagatccaggcagccttccgggagccacggcttcttgtggttactgaccccagggctgaccaccagcctctcacggaggcatcttatgttaacctacctaccattgcgctgtgtaacacagattctcctctgcgctatgtggacattgccatcccatgcaacaacaagggagctcactcagtgggtttgatgtggtggatgctggctcgggaagttctgcgcatgcgtggcaccatttcccgtgaacacccatgggaggtcatgcctgatctgtacttctacagagatcctgaagagattgaaaaagaagagcaggctgctgctgagaaggcagtgaccaaggaggaatttcagggtgaatggactgctcccgctcctgagttcactgctactcagcctgaggttgcagactggtctgaaggtgtacaggtgccctctgtgcctattcagcaattccctactgaagactggagcgctcagcctgccacggaagactggtctgcagctcccactgctcaggccactgaatgggtaggagcaaccactgactggtcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - jun B proto-oncogene - WD repeat domain 45 - lipoyltransferase 1 - lipoyltransferase 1 |