Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene
PTXBC036723
New product
Data sheet of FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036723 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCGR3A |
| Origin species: | Human |
| Product name: | FCGR3A-Fc fragment of IgG, low affinity IIIa, receptor (CD16a) Gene |
| Size: | 2ug |
| Accessions: | BC036723 |
| Gene id: | 2214 |
| Gene description: | Fc fragment of IgG, low affinity IIIa, receptor (CD16a) |
| Synonyms: | CD16A; FCG3; FCGR3; FCGRIII; FCR-10; FCRIII; FCRIIIA; IGFR3; IMD20; low affinity immunoglobulin gamma Fc region receptor III-A; CD16a antigen; Fc fragment of IgG low affinity IIIa receptor; Fc fragment of IgG, low affinity III, receptor for (CD16); Fc fragment of IgG, low affinity IIIa, receptor (CD16a); Fc gamma receptor III-A; Fc gamma receptor IIIa; Fc-gamma RIII-alpha; Fc-gamma RIIIa; Fc-gamma receptor III-2 (CD 16); Fc-gamma receptor IIIb (CD16); FcgammaRIIIA; fc-gamma RIII; igG Fc receptor III-2; immunoglobulin G Fc receptor III; neutrophil-specific antigen NA; Fc fragment of IgG receptor IIIa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtggaggggctggggaaaggctgtttacttcctcctgtctagtcggtttggtccctttagggctccggatatctttggtgacttgtcctctccagtgtggcatcatgtggcagctgctcctcccaactgctctgctacttctagtttcagctggcatgcggactgaagatctcccaaaggctgtggtgttcctggagcctcaatggtacagggtgctcgagaaggacagtgtgactctgaagtgccagggagcctactcccctgaggacaattccacacagtggtttcacaatgagagcctcatctcaagccaggcctcgagctacttcattgacgctgccacagtcgacgacagtggagagtacaggtgccagacaaacctctccaccctcagtgacccggtgcagctagaagtccatatcggctggctgttgctccaggcccctcggtgggtgttcaaggaggaagaccctattcacctgaggtgtcacagctggaagaacactgctctgcataaggtcacatatttacagaatggcaaaggcaggaagtattttcatcataattctgacttctacattccaaaagccacactcaaagacagcggctcctacttctgcagggggcttgttgggagtaaaaatgtgtcttcagagactgtgaacatcaccatcactcaaggtttggcagtgtcaaccatctcatcattctttccacctgggtaccaagtctctttctgcttggtgatggtactcctttttgcagtggacacaggactatatttctctgtgaagacaaacattcgaagctcaacaagagactggaaggaccataaatttaaatggagaaaggaccctcaagacaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - StAR-related lipid transfer (START) domain containing 7 - polymerase (DNA-directed), delta interacting protein 2 - telomeric repeat binding factor 2, interacting protein - RNA binding motif, single stranded interacting protein 1 |