PTXBC000311
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC000311 |
Product type: | DNA & cDNA |
Ncbi symbol: | KLF6 |
Origin species: | Human |
Product name: | KLF6-Kruppel-like factor 6 Gene |
Size: | 2ug |
Accessions: | BC000311 |
Gene id: | 1316 |
Gene description: | Kruppel-like factor 6 |
Synonyms: | BCD1; CBA1; COPEB; CPBP; GBF; PAC1; ST12; ZF9; Krueppel-like factor 6; B-cell-derived protein 1; GC-rich binding factor; GC-rich sites-binding factor GBF; Kruppel-like zinc finger protein Zf9; core promoter element-binding protein; proto-oncogene BCD1; protooncogene B-cell derived 1; suppression of tumorigenicity 12 (prostate); suppressor of tumorigenicity 12 protein; transcription factor Zf9; Kruppel like factor 6 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggacgtgctccccatgtgcagcatcttccaggagctccagatcgtgcacgagaccggctacttctcggcgctgccgtctctggaggagtactggcaacagacctgcctagagctggaacgttacctccagagcgagccctgctatgtttcagcctcagaaatcaaatttgacagccaggaagatctgtggaccaaaatcattctggctcgggagaaaaaggaggaatccgaactgaagatatcttccagtcctccagaggacactctcatcagcccgagcttttgttacaacttagagaccaacagcctgaactcagatgtcagcagcgaatcctctgacagctccgaggaactttctcccacggccaagtttacctccgaccccattggcgaagttttggtcagctcgggaaaattgagctcctctgtcacctccacgcctccatcttctccggaactgagcagggaaccttctcaactgtggggttgcgtgcccggggagctgccctcgccagggaaggtgcgcagcgggacttcggggaagccaggtgacaagggaaatggcgatgcctcccccgacggcaggaggagggtgcaccggtgccactttaacggctgcaggaaagtttacaccaaaagctcccacttgaaagcacaccagcggacgcacacaggagaaaagccttacagatgctcatgggaagggtgtgagtggcgttttgcaagaagtgatgagttaaccaggcacttccgaaagcacaccggggccaagccttttaaatgctcccactgtgacaggtgtttttccaggtctgaccacctggccctgcacatgaagaggcacctctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - UBX domain protein 1 - NDRG family member 2 - NDRG family member 2 - creatine kinase, brain |