Cart 3 Product Products 337,68 € (empty)
-
1 x CLEC4E-C-t...113,40 € -
1 x RLBP1L2-re...121,50 € -
No products
To be determined Shipping
337,68 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 337,68 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 337,68 €
Data sheet of ELA3A-elastase 3A, pancreatic Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ELA3A-elastase 3A, pancreatic Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008383 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELA3A |
| Origin species: | Human |
| Product name: | ELA3A-elastase 3A, pancreatic Gene |
| Size: | 2ug |
| Accessions: | BC008383 |
| Gene id: | 10136 |
| Gene description: | elastase 3A, pancreatic |
| Synonyms: | ELA3A; ELA3; chymotrypsin-like elastase family member 3A; elastase 1; elastase 3A, pancreatic; elastase IIIA; elastase-3A; protease E; chymotrypsin like elastase family member 3A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgctccagctgctcagttccctcctccttgtggccgttgcctcaggctatggcccaccttcctctcactcttccagccgcgttgtccatggtgaggatgcggtcccctacagctggccctggcaggtttccctgcagtatgagaaaagtggaagcttctaccacacgtgtggcggtagcctcatcgcccccgattgggttgtgactgccggccactgcatctcgagggatctgacctaccaggtggtgttgggtgagtacaaccttgctgtgaaggagggccccgagcaggtgatccccatcaactctgaggagctgtttgtgcatccactctggaaccgctcgtgtgtggcctgtggcaatgacatcgccctcatcaagctctcacgcagcgcccagctgggagatgccgtccagctcgcctcactccctcccgctggtgacatccttcccaacaagacaccctgctacatcaccggctggggccgtctctataccaatgggccactcccagacaagctgcagcaggcccggctgcccgtggtggactataagcactgctccaggtggaactggtggggttccaccgtgaagaaaaccatggtgtgtgctggagggtacatccgctccggctgcaacggtgactctggaggacccctcaactgccccacagaggatggtggctggcaggtccacggtgtgaccagctttgtttctggctttggctgcaacttcatctggaagcccacggtgttcactcgagtctccgccttcatcgactggattgaggagaccatagcaagccactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras suppressor protein 1 - SH3-domain GRB2-like 2 - fatty acid 2-hydroxylase - histone deacetylase 11 |