Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene
PTXBC000331
New product
Data sheet of PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000331 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMB4 |
| Origin species: | Human |
| Product name: | PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene |
| Size: | 2ug |
| Accessions: | BC000331 |
| Gene id: | 5692 |
| Gene description: | proteasome (prosome, macropain) subunit, beta type, 4 |
| Synonyms: | HN3; HsN3; PROS-26; PROS26; proteasome subunit beta type-4; 26 kDa prosomal protein; hsBPROS26; macropain beta chain; multicatalytic endopeptidase complex beta chain; proteasome (prosome, macropain) subunit, beta type, 4; proteasome beta chain; proteasome chain 3; proteasome subunit HsN3; proteasome subunit, beta type, 4; testis tissue sperm-binding protein Li 79P; proteasome subunit beta 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagcgtttttggggtcgcggtccggactttgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgttaagttcgagggcggagtggtgattgccgcagacatgctgggatcctacggctccttggctcgtttccgcaacatctctcgcattatgcgagtcaacaacagtaccatgctgggtgcctctggcgactacgctgatttccagtatttgaagcaagttctcggccagatggtgattgatgaggagcttctgggagatggacacagctatagtcctagagctattcattcatggctgaccagggccatgtacagccggcgctcgaagatgaaccctttgtggaacaccatggtcatcggaggctatgctgatggagagagcttcctcggttatgtggacatgcttggtgtagcctatgaagccccttcgctggccactggttatggtgcatacttggctcagcctctgctgcgagaagttctggagaagcagccagtgctaagccagaccgaggcccgcgacttagtagaacgctgcatgcgagtgctgtactaccgagatgcccgttcttacaaccggtttcaaaccgccactgtcaccgaaaaaggtgttgaaatagagggaccattgtctacagagaccaactgggatattgcccacatgatcagtggctttgaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleophosmin (nucleolar phosphoprotein B23, numatrin) - eukaryotic translation initiation factor 3, subunit G - membrane bound O-acyltransferase domain containing 7 - eukaryotic translation initiation factor 3, subunit F |