Cart 46 Product Products 6 233,86 € (empty)
-
-
1 x TGFB1-tran...121,50 € -
-
1 x TRAF4...259,07 € -
-
1 x MRPL36-mit...113,40 € -
-
1 x COX7A2L-cy...113,40 € -
1 x FAM83F-fam...121,50 € -
1 x PTDSS2-pho...121,50 € -
1 x STH-saitoh...113,40 € -
1 x OMG-oligod...121,50 € -
1 x Ret...259,07 € -
1 x C2orf53-ch...121,50 € -
1 x CD320-CD32...121,50 € -
-
1 x C15orf23-c...121,50 € -
1 x ATP1B1-ATP...121,50 € -
1 x JMJD7-jumo...121,50 € -
1 x LHR...259,07 € -
-
-
-
1 x FAM122B-fa...113,40 € -
1 x RUVBL2-Ruv...113,40 € -
1 x C6orf123-c...113,40 € -
1 x C19orf39-c...113,40 € -
1 x CAPZB-capp...121,50 € -
-
1 x TMEM126B-t...113,40 € -
1 x TULP1-tubb...121,50 € -
1 x NCALD-neur...113,40 € -
1 x TANK-TRAF...121,50 € -
-
1 x SLC25A11-s...121,50 € -
1 x CCDC50-coi...121,50 € -
1 x ADIPOQ-adi...113,40 € -
-
1 x ASNA1-arsA...121,50 € -
1 x KLHDC4-kel...121,50 € -
1 x KIAA1486-K...113,40 € -
-
1 x CST8-cysta...113,40 € -
1 x LONRF1-LON...121,50 € -
1 x ETNK2-etha...121,50 € -
1 x C3orf35-ch...113,40 €
No products
To be determined Shipping
6 233,86 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 46 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 233,86 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 233,86 €
Data sheet of SNAI1-snail homolog 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNAI1-snail homolog 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012910 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNAI1 |
| Origin species: | Human |
| Product name: | SNAI1-snail homolog 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC012910 |
| Gene id: | 6615 |
| Gene description: | snail homolog 1 (Drosophila) |
| Synonyms: | zinc finger protein SNAI1; SLUGH2; SNA; SNAH; SNAIL; SNAIL1; dJ710H13.1; protein sna; protein snail homolog 1; snail 1 homolog; snail 1 zinc finger protein; snail family zinc finger 1; snail homolog 1; snail family transcriptional repressor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagcgagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctgctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgctcatctgggactctgtcctggcgccccaagcccagccaattgcctgggcctcccttcggctccaggagagtcccagggtggcagagctgacctccctgtcagatgaggacagtgggaaaggctcccagccccccagcccaccctcaccggctccttcgtccttctcctctacttcagtctcttccttggaggccgaggcctatgctgccttcccaggcttgggccaagtgcccaagcagctggcccagctctctgaggccaaggatctccaggctcgaaaggccttcaactgcaaatactgcaacaaggaatacctcagcctgggtgccctcaagatgcacatccgaagccacacgctgccctgcgtctgcggaacctgcgggaaggccttctctaggccctggctgctacaaggccatgtccggacccacactggcgagaagcccttctcctgtccccactgcagccgtgccttcgctgaccgctccaacctgcgggcccacctccagacccactcagatgtcaagaagtaccagtgccaggcgtgtgctcggaccttctcccgaatgtccctgctccacaagcaccaagagtccggctgctcaggatgtccccgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - integral membrane protein 2B - RNA binding motif protein 11 - Yip1 domain family, member 2 - ribosomal protein, large, P0 |