PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene View larger

PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene

PTXBC008314

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008314
Product type: DNA & cDNA
Ncbi symbol: PSMB4
Origin species: Human
Product name: PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene
Size: 2ug
Accessions: BC008314
Gene id: 5692
Gene description: proteasome (prosome, macropain) subunit, beta type, 4
Synonyms: HN3; HsN3; PROS-26; PROS26; proteasome subunit beta type-4; 26 kDa prosomal protein; hsBPROS26; macropain beta chain; multicatalytic endopeptidase complex beta chain; proteasome (prosome, macropain) subunit, beta type, 4; proteasome beta chain; proteasome chain 3; proteasome subunit HsN3; proteasome subunit, beta type, 4; testis tissue sperm-binding protein Li 79P; proteasome subunit beta 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagcgtttttggggtcgcggtccggactctgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgttaagttcgagggcggagtggtgattgccgcagacatgctgggatcctacggctccttggctcgtttccgcaacatctctcgcattatgcgagtcaacaacagtaccatgctgggtgcctctggcgactacgctgatttccagtatttgaagcaagttctcggccagatggtgattgatgaggagcttctgggagatggacacagctatagtcctagagctattcattcatggctgaccagggccatgtacagccggcgctcgaagatgaaccctttgtggaacaccatggtcatcggaggctatgctgatggagagagcttcctcggttatgtggacatgcttggtgtagcctatgaagccccttcgctggccactggttatggtgcatacttggctcagcctctgctgcgagaagttctggagaagcagccagtgctaagccagaccgaggcccgcgacttagtagaacgctgcatgcgagtgctgtactaccgagatgcccgttcttacaaccggtttcaaatcgccactgtcaccgaaaaaggtgttgaaatagagggaccattgtctacagagaccaactgggatattgcccacatgatcagtggctttgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) subunit, beta type, 4
- proteasome (prosome, macropain) subunit, beta type, 4
- nucleophosmin (nucleolar phosphoprotein B23, numatrin)
- eukaryotic translation initiation factor 3, subunit G

Reviews

Buy PSMB4-proteasome (prosome, macropain) subunit, beta type, 4 Gene now

Add to cart