FRMPD2-FERM and PDZ domain containing 2 Gene View larger

FRMPD2-FERM and PDZ domain containing 2 Gene

PTXBC031614

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FRMPD2-FERM and PDZ domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FRMPD2-FERM and PDZ domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031614
Product type: DNA & cDNA
Ncbi symbol: FRMPD2
Origin species: Human
Product name: FRMPD2-FERM and PDZ domain containing 2 Gene
Size: 2ug
Accessions: BC031614
Gene id: 143162
Gene description: FERM and PDZ domain containing 2
Synonyms: PDZD5C; PDZK4; PDZK5C; FERM and PDZ domain-containing protein 2; PDZ domain containing 5C; PDZ domain-containing protein 4; FERM and PDZ domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagatgaacgcacggctgtttccttggtaacagccttgcctggcaggccttcgagctgtgtctcagtgacagatggtcctaagtttgaagtcaaactaaaaaagaatgccaatggtttgggattcagtttcgtgcagatggagaaagagagctgcagccatctcaaaagtgatcttgtgaggattaagaggctctttccggggcagccagctgaggagaatggggccattgcagctggtgacattatcctggccgtgaatggaaggtccacggaaggcctcatcttccaggaggtgctgcatttactgagaggggccccacaggaagtcacgctcctcctttgccgaccccctccaggtgcgctgcctgagctggagcaggaatggcagacacctgaactctcagctgacaaagaattcaccagggcaacatgtactgactcatgtaccagccccatcctggatcaagaggacagctggagggacagtgcctccccagatgcaggggaaggcctgggtctcaggccagagtcttcccaaaaggccatcagagaggcacaatggggccaaaacagagagagaccttgggccagttccttgacacattctcctgagtcccaccctcatttatgcaaacttcaccaagaaagggatgaatcaacattggcgacctctttggaaaaggatgtgaggcaaaactgctattcagtttgtgatatcatgagacttggaagatattccttctcatctcctctaaccagactttcgacagatattttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - voltage-dependent anion channel 2
- centrosomal protein 170kDa-like
- coiled-coil domain containing 24
- coiled-coil domain containing 82

Reviews

Buy FRMPD2-FERM and PDZ domain containing 2 Gene now

Add to cart