PTXBC008455
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC008455 |
Product type: | DNA & cDNA |
Ncbi symbol: | USE1 |
Origin species: | Human |
Product name: | USE1-unconventional SNARE in the ER 1 homolog (S. cerevisiae) Gene |
Size: | 2ug |
Accessions: | BC008455 |
Gene id: | 55850 |
Gene description: | unconventional SNARE in the ER 1 homolog (S. cerevisiae) |
Synonyms: | USE1-like protein; vesicle transport protein USE1; D12; MDS032; P31; SLT1; Q-SNARE; SNARE-like tail-anchored protein 1 homolog; protein p31; unconventional SNARE in the ER 1 homolog; unconventional SNARE in the ER 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcggcgtcgaggctggagctaaacctggtgcggctgctatcccgctgcgaggcgatggcagcggagaaacgggacccggacgagtggcgcctggagaagtacgtgggagccctagaggacatgttgcaggccctgaaggtccacgcgagcaaaccggcctctgaggtgatcaatgaatattcctggaaggtggattttctgaaggggatgctgcaagccgagaagctgacctcctcctcagagaaagcactggccaaccagttcctggcccctggccgtgtgccaaccacagccagagagcgagtgcccgccacaaagacggtgcatctgcagtcacgggcgcggtacaccagcgagatgcggagtgagctactaggcacggactctgcagagcctgagatggacgtaaggaagagaactggagtggcagggtcccagccagtgagtgagaagcagtcggcagctgagctagacctcgtcctgcagcgacatcagaacctccaggaaaagctggcggaagagatgctaggactggcccggagcctcaagaccaataccctggccgcccagagtgtcatcaagaaggacaaccagaccctgtcacactcactgaaaatggcggaccagaacctggagaaactgaagacggagtcagagcgtctggagcagcacacgcagaagtcagtcaactggctgctctgggccatgctcattatcgtctgcttcatcttcattagcatgatcctcttcattcgaatcatgcctaaactcaaataa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - phosphatidylinositol glycan anchor biosynthesis, class C - potassium channel tetramerisation domain containing 17 - twinfilin, actin-binding protein, homolog 2 (Drosophila) - twinfilin, actin-binding protein, homolog 2 (Drosophila) |