Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ASB9-ankyrin repeat and SOCS box-containing 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASB9-ankyrin repeat and SOCS box-containing 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001244 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASB9 |
| Origin species: | Human |
| Product name: | ASB9-ankyrin repeat and SOCS box-containing 9 Gene |
| Size: | 2ug |
| Accessions: | BC001244 |
| Gene id: | 140462 |
| Gene description: | ankyrin repeat and SOCS box-containing 9 |
| Synonyms: | ankyrin repeat and SOCS box protein 9; ASB-9; ankyrin repeat and suppressor of cytokine signaling box protein 9; testis tissue sperm-binding protein Li 57p; ankyrin repeat and SOCS box containing 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatggcaaacaagggggcatggatgggagcaagcccgcggggccaagggactttcctggcatcaggcttctttcaaacccattgatgggcgatgctgtgtctgattggtctcctatgcatgaagctgcaatccacggacatcagctgtctctgaggaacctcatcagccaggggtgggctgtgaacatcatcacggcagatcatgtttccccactccatgaagcctgtcttggaggtcatctctcttgtgtgaagattttattaaagcatggagctcaggtgaatggtgtgacagcagactggcacactccactgtttaatgcttgtgtcagcggcagctgggattgtgtgaatttgcttctgcagcacggagccagcgttcaacctgagagtgatctggcatcccccatccatgaagctgctaggagagcttatgggggcaacattgaccataagatcagccacctgggcactccactctatttggcttgtgaaaaccaacagagagcctgtgtcaagaagcttctggagtcaggagcggacgtgaaccaagggaaaggtcaggattccccacttcatgcagtggccaggacagccagtgaagagctggcctgcctgctcatggattttggagcggacacccaggccaagaatgctgaaggcaaacgtcctgtggagctggtgcctccagagagccccttggcccagctcttcttggagagagaaggtgcttctttgccaaaacctaagccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - inositol(myo)-1(or 4)-monophosphatase 1 - developmental pluripotency associated 2 - retinal outer segment membrane protein 1 - coxsackie virus and adenovirus receptor |