Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene
PTXBC035012
New product
Data sheet of UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035012 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UGT3A1 |
| Origin species: | Human |
| Product name: | UGT3A1-UDP glycosyltransferase 3 family, polypeptide A1 Gene |
| Size: | 2ug |
| Accessions: | BC035012 |
| Gene id: | 133688 |
| Gene description: | UDP glycosyltransferase 3 family, polypeptide A1 |
| Synonyms: | UDP-glucuronosyltransferase 3A1; UDP glycosyltransferase 3 family, polypeptide A1; UDPGT 3A1; UDP glycosyltransferase family 3 member A1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttcatcagagtggaaagtttttgatcccagatattaaagaggaggaaaaatcataccaagttatcaggtggttttcacctgaagatcatcaaaaaagaattaagaagcattttgatagctacatagaaacagcattggatggcagaaaagaatctgaagcccttgtaaagctaatggaaatatttgggactcaatgtagttatttgctaagcagaaaggatataatggattccttaaagaatgagaactatgatctggtatttgttgaagcatttgatttctgttctttcctgattgctgagaagcttgtgaaaccatttgtggccattcttcccaccacattcggctctttggattttgggctaccaagccccttgtcttatgttccagtattcccttccttgctgactgatcacatggacttctggggccgagtgaagaattttctgatgttctttagtttctccaggagccaatgggacatgcagtctacatttgacaacaccatcaaggagcatttcccagaaggctctaggccagttttgtctcatcttctactgaaagcagagttgtggtttgttaactctgattttgcctttgattttgcccggcccctgcttcccaacactgtttatattggaggcttgatggaaaaacctattaaaccagtaccacaaaatgggcaaccagctctcttcaccacccccagcttattctcctctggagtgtatcctgaaccactgagacggctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - non imprinted in Prader-Willi/Angelman syndrome 1 - pseudouridylate synthase 7 homolog (S. cerevisiae) - family with sequence similarity 108, member A1 - retinol dehydrogenase 12 (all-trans/9-cis/11-cis) |