Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GZMH-granzyme H (cathepsin G-like 2, protein h-CCPX) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GZMH-granzyme H (cathepsin G-like 2, protein h-CCPX) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027974 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GZMH |
| Origin species: | Human |
| Product name: | GZMH-granzyme H (cathepsin G-like 2, protein h-CCPX) Gene |
| Size: | 2ug |
| Accessions: | BC027974 |
| Gene id: | 2999 |
| Gene description: | granzyme H (cathepsin G-like 2, protein h-CCPX) |
| Synonyms: | CCP-X; CGL-2; CSP-C; CTLA1; CTSGL2; cathepsin G-like 2, protein h-CCPX; cytotoxic T-lymphocyte proteinase; cytotoxic T-lymphocyte-associated serine esterase 1; cytotoxin serine protease-C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagccattcctcctcctgttggcctttcttctgacccctggggctgggacagaggagatcatcgggggccatgaggccaagccccactcccgcccctacatggcctttgttcagtttctgcaagagaagagtcggaagaggtgtggcggcatcctagtgagaaaggactttgtgctgacagctgctcactgccagggaagctccataaatgtcaccttgggggcccacaatatcaaggaacaggagcggacccagcagtttatccctgtgaaaagacccatcccccatccagcctataatcctaagaacttctccaacgacatcatgctactgcagctggagagaaaggccaagtggaccacagctgtgcggcctctcaggctacctagcagcaaggcccaggtgaagccagggcagctgtgcagtgtggctggctggggttatgtctcaatgagcactttagcaaccacactgcaggaagtgttgctgacagtgcagaaggactgccagtgtgaacgtctcttccatggcaattacagcagagccactgagatttgtgtgggggatccaaagaagacacagaccggtttcaagggggactccggggggcccctcgtgtgtaaggacgtagcccaaggtattctctcctatggaaacaaaaaagggacacctccaggagtctacatcaaggtctcacacttcctgccctggataaagagaacaatgaagcgcctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Spi-C transcription factor (Spi-1/PU.1 related) - T-cell activation RhoGTPase activating protein - capping protein (actin filament), gelsolin-like - glutamate-ammonia ligase (glutamine synthetase) |