Cart 9 Product Products 1 461,01 € (empty)
-
1 x ABHD14B-ab...113,40 € -
1 x CLEC4D-C-t...113,40 € -
1 x NNAT-neuro...113,40 € -
1 x CLRN3-clar...113,40 € -
1 x HHEX-hemat...121,50 € -
1 x HFE-hemoch...121,50 € -
-
-
No products
To be determined Shipping
1 461,01 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 461,01 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 461,01 €
View larger 
Data sheet of DECR2-2,4-dienoyl CoA reductase 2, peroxisomal Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DECR2-2,4-dienoyl CoA reductase 2, peroxisomal Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011968 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DECR2 |
| Origin species: | Human |
| Product name: | DECR2-2,4-dienoyl CoA reductase 2, peroxisomal Gene |
| Size: | 2ug |
| Accessions: | BC011968 |
| Gene id: | 26063 |
| Gene description: | 2,4-dienoyl CoA reductase 2, peroxisomal |
| Synonyms: | PDCR; SDR17C1; peroxisomal 2,4-dienoyl-CoA reductase; 2,4-dienoyl-CoA reductase 2, peroxisomal; short chain dehydrogenase/reductase family 17C member 1; 2,4-dienoyl-CoA reductase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggcacggctgccatacggtgattgccagtaggagcctgccgcgagtgctgacggccgccaggaagctggctggggccaccggccggcgctgcctccctctctctatggacgtccgagcgcccccagctgtcatggccgccgtggaccaggctctgaaggagtttggcagaatcgacattctcattaactgtgcggccgggaacttcctgtgccccgctggcgccttgtccttcaacgccttcaagaccgtgatggacatcgataccagcggcaccttcaatgtgtctcgtgtgctctatgagaagttcttccgggaccacggaggggtgatcgtgaacatcactgccaccctggggaaccgggggcaggcgctccaggtgcatgcaggctccgccaaggccgctgtggacgcgatgacgcggcacttggctgtggagtggggtccccaaaacatccgcgtcaacagcctcgcccctggccccatcagtggcacagaggggctccggcgactgggtggccctcaggccagcctgagcaccaaggtcactgccagcccgctgcagaggctggggaacaagaccgagatcgcccacagcgtgctctacctggccagccctctggcttcctacgtgacgggggccgtgctggtggccgatggcggggcatggttgacgttcccaaacggtgtcaaagggctgccggatttcgcatccttctctgctaagctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fragile X mental retardation 1 neighbor - cytokine inducible SH2-containing protein - rapamycin-insensitive companion of mTOR - C-type lectin domain family 1, member A |