Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene
PTXBC000983
New product
Data sheet of RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000983 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RBCK1 |
| Origin species: | Human |
| Product name: | RBCK1-RanBP-type and C3HC4-type zinc finger containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC000983 |
| Gene id: | 10616 |
| Gene description: | RanBP-type and C3HC4-type zinc finger containing 1 |
| Synonyms: | C20orf18; HOIL-1; HOIL1; PBMEI; PGBM1; RBCK2; RNF54; UBCE7IP3; XAP3; XAP4; ZRANB4; ranBP-type and C3HC4-type zinc finger-containing protein 1; HBV-associated factor 4; RBCC protein interacting with PKC1; RING finger protein 54; heme-oxidized IRP2 ubiquitin ligase 1; hepatitis B virus X-associated protein 4; ubiquitin conjugating enzyme 7 interacting protein 3; RANBP2-type and C3HC4-type zinc finger containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcacagccacgccagatggacgagaagaccaagaaaggctgtgggtgagcgtggaggatgctcagatgcacaccgtcaccatctggctcacagtgcgccctgatatgacagtggcgtctctcaaggacatggtttttctggactatggcttcccaccagtcttgcagcagtgggtgattgggcagcggctggcacgagaccaggagaccctgcactcccatggggtgcggcagaatggggacagtgcctacctctatctgctgtcagcccgcaacacctccctcaaccctcaggagctgcagcgggagcggcagctgcggatgctggaagatctgggcttcaaggacctcacgctgcagccgcggggccctctggagccaggccccccaaagcccggggtcccccaggaacccggacgggggcagccagatgcagtgcctgagcccccaccggtgggctggcagtgccccgggtgcaccttcatcaacaagcccacgcggcctggctgtgagatgtgctgccgggcgcgccccgaggcctaccaggtccccgcctcataccagcccgacgaggaggagcgagcgcgcctggcgggcgaggaggaggcgctgcgtcagtaccagcagggagtgcctgcagggcaccatccgcaacagccaggaggcggaggtctcctgccccttcattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP-binding cassette, sub-family D (ALD), member 3 - ORAI calcium release-activated calcium modulator 1 - mitochondrial translational release factor 1-like - GTP binding protein overexpressed in skeletal muscle |