Cart 8 Product Products 942,30 € (empty)
-
1 x CHMP6-chro...113,40 € -
-
1 x KRR1-KRR1,...121,50 € -
1 x PVRL3-poli...121,50 € -
1 x SLC22A24-s...121,50 € -
1 x CTSE-cathe...121,50 € -
-
No products
To be determined Shipping
942,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 942,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 942,30 €
View larger 
Data sheet of SCAMP4-secretory carrier membrane protein 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCAMP4-secretory carrier membrane protein 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011747 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCAMP4 |
| Origin species: | Human |
| Product name: | SCAMP4-secretory carrier membrane protein 4 Gene |
| Size: | 2ug |
| Accessions: | BC011747 |
| Gene id: | 113178 |
| Gene description: | secretory carrier membrane protein 4 |
| Synonyms: | SCAMP-4; secretory carrier-associated membrane protein 4; secretory carrier membrane protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagaaaaggagaacaacttcccgccactgcccaagttcatccctgtgaagccctgcttctaccagaacttctccgacgagatcccagtggagcaccaggtcctggtgaagaggatctaccggctgtggatgttttactgcgccaccctcggcgtcaacctcattgcctgcctggcctggtggatcggcggaggctcggggaccaacttcggcctggccttcgtgtggctgctcctgttcacgccttgcggctacgtgtgctggttccggcctgtctacaaggccttccgagccgacagctcctttaatttcatggcgtttttcttcatcttcggagcccagtttgtcctgaccgtcatccaggcgattggcttctccggctggggcgcgtgcggctggctgtcggcaattggattcttccagtacagcccgggcgctgccgtggtcatgctgcttccagccatcatgttctccgtgtcggctgccatgatggccatcgcgatcatgaaggtgcacaggatctaccgaggggctggcggaagcttccagaaggcacagacggagtggaacacgggcacttggcggaacccaccgtcgagggaggcccagtacaacaacttctcaggcaacagcctgcccgagtaccccactgtgcccagctacccgggcagtggccagtggccttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - secretory carrier membrane protein 5 - secretory carrier membrane protein 3 - milk fat globule-EGF factor 8 protein - butyrophilin, subfamily 2, member A2 |