Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V1E2-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 Gene
PTXBC008981
New product
Data sheet of ATP6V1E2-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V1E2-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008981 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V1E2 |
| Origin species: | Human |
| Product name: | ATP6V1E2-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 Gene |
| Size: | 2ug |
| Accessions: | BC008981 |
| Gene id: | 90423 |
| Gene description: | ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 |
| Synonyms: | ATP6E1; ATP6EL2; ATP6V1EL2; VMA4; V-type proton ATPase subunit E 2; ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2; V-ATPase subunit E 2; testis secretory sperm-binding protein Li 235P; vacuolar proton pump subunit E 2; vacuolar-type proton-translocating ATPase subunit E1; ATPase H+ transporting V1 subunit E2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctgagtgatgtcgatgtgaaaaagcagattaagcacatgatggctttcattgagcaggaagccaatgagaaagcagaggaaatcgatgccaaggctgaggaagagtttaacattgagaaaggacgcctcgtgcaaacccaacgactgaagattatggagtattatgagaaaaaggagaagcagatagagcagcagaagaaaatcctgatgtccaccatgaggaatcaggcgaggctgaaagtcctgagagcccgaaatgacctcatctcagatttgctcagtgaggcgaagctgagactcagcaggattgtggaggacccagaggtctaccaggggctgctggataaactggtgctccagggtctgctccgactgctggaacctgtgatgattgtacgctgccggccacaagacctcctcctggtggaggctgctgtacaaaaagccatccccgagtacatgacaatttcccagaaacatgtggaggtccagattgataaagaggcatacctggctgtgaatgcagctggaggtgtggaggtctacagtggcaatcagagaataaaggtttcaaataccttggaaagccgactggatctctcagccaagcaaaagatgccagaaatacgaatggccttgtttggtgctaacaccaacagaaagttctttatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) - ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 - proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 - sterile alpha motif and leucine zipper containing kinase AZK |