Cart 5 Product Products 728,87 € (empty)
-
1 x FLJ20628-h...121,50 € -
1 x Centriolin...259,07 € -
1 x ARHGAP15-R...121,50 € -
1 x PCLO-picco...113,40 € -
1 x KIAA0040-K...113,40 €
No products
To be determined Shipping
728,87 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 728,87 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 728,87 €
Data sheet of ZNF672-zinc finger protein 672 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF672-zinc finger protein 672 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008872 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF672 |
| Origin species: | Human |
| Product name: | ZNF672-zinc finger protein 672 Gene |
| Size: | 2ug |
| Accessions: | BC008872 |
| Gene id: | 79894 |
| Gene description: | zinc finger protein 672 |
| Synonyms: | zinc finger protein 672 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttgccacatctggggcagtggcagcggggaagccttactcgtgcagcgaatgtggcaagagcttctgctacagctcagtgctgctgcgacatgaacgagctcacggcggtgacggccgcttccgttgcctagaatgcggtgagcgctgtgcacgggctgctgacctccgagcgcacaggcgcacgcatgctggccagaccctctacatctgcagtgagtgcggacaaagcttccgccacagcggccgtcttgacctacacttgggcgcacaccggcagcgatgccgcacttgcccctgccgcacatgcggccggcgcttcccgcacctccccgcgctgctgctacaccggcgccgccagcatctgccagagcggccccttttgccatgctgtcctcgtataactcggattctctcctcaggtgtaggtgcagggagtcagggaacccttagactcccctgtgtgcaagagcccaggtgttggtgtgtccctttaatgctactgtgctctctggtgtttctgattttcctgcctttattctgtcttctcttgtcctatctcattccagcccacatcttctcctttcctgattacttttgttgtcctgcctcttcaggtaatggtcacagatttggctgtaggcacgttaccagccctgtggcttcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ring finger protein 114 - ring finger protein 141 - ring finger protein 125 - zinc finger protein 174 |