NUDCD3-NudC domain containing 3 Gene View larger

NUDCD3-NudC domain containing 3 Gene

PTXBC003691

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUDCD3-NudC domain containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUDCD3-NudC domain containing 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003691
Product type: DNA & cDNA
Ncbi symbol: NUDCD3
Origin species: Human
Product name: NUDCD3-NudC domain containing 3 Gene
Size: 2ug
Accessions: BC003691
Gene id: 23386
Gene description: NudC domain containing 3
Synonyms: NudCL; nudC domain-containing protein 3; NudC-like protein; NudC domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccatggttcacaggaggcagaagctccaggagcagttgctggtgctgctgaagtccctagggaaccaccaattcttcccaggattcaggagcagttccagaaaaatcccgacagttacaatggtgctgtccgagagaactacacctggtcacaggactatactgacctggaggtcagggtgccagtacccaagcacgtggtgaagggaaagcaggtctcagtggcccttagcagcagctccattcgtgtggccatgctggaggaaaatggggagcgcgtcctcatggaagggaagctcacccacaagatcaacactgagagttctctctggagtctcgagcccgggaagtgcgttttggtgaacctgagcaaggtgggcgagtattggtggaacgccatcctggagggagaagagcccatcgacattgacaagatcaacaaggagcgctccatggccaccgtggatgaggaggaacaggcggtgttggacaggcttacctttgactaccaccagaagctgcagggcaagccacagagccatgagctgaaagtccatgagatgctgaagaaggggtgggatgctgaaggttctcccttccgaggccagcgattcgaccctgccatgttcaacatctccccgggggctgtgcagttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acyl-CoA thioesterase 11
- transmembrane protein 54
- HEAT repeat containing 2
- transmembrane protein 33

Reviews

Buy NUDCD3-NudC domain containing 3 Gene now

Add to cart