Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GSTM4-glutathione S-transferase mu 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GSTM4-glutathione S-transferase mu 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015513 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GSTM4 |
| Origin species: | Human |
| Product name: | GSTM4-glutathione S-transferase mu 4 Gene |
| Size: | 2ug |
| Accessions: | BC015513 |
| Gene id: | 2948 |
| Gene description: | glutathione S-transferase mu 4 |
| Synonyms: | GSTM4-4; GTM4; glutathione S-transferase Mu 4; GST class-mu 4; GST-Mu2; GTS-Mu2; S-(hydroxyalkyl)glutathione lyase M4; glutathione S-alkyltransferase M4; glutathione S-aralkyltransferase M4; glutathione S-aryltransferase M4; glutathione S-transferase M4; testis tissue sperm-binding protein Li 60n |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccatgacactggggtactgggacatccgcgggctggcccacgccatccgcctgctcctggaatacacagactcaagctacgaggaaaagaagtatacgatgggggacgctcctgactatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaatctgccctacttgattgatggggctcacaagatcacccagagcaacgccatcctgtgctacattgcccgcaagcacaacctgtgtggggagacagaagaggagaagattcgtgtggacattttggagaaccaggctatggacgtctccaatcagctggccagagtctgctacagccctgactttgagaaactgaagccagaatacttggaggaacttcctacaatgatgcagcacttctcacagttcctggggaagaggccatggtttgttggagacaagatcacctttgtagatttcctcgcctatgatgtccttgacctccaccgtatatttgagcccaactgcttggacgccttcccaaatctgaaggacttcatctcccgctttgagggcttggagaagatctctgcctacatgaagtccagccgcttcctcccaaaacctctgtacacaagggtggctgtctggggcaacaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATP/GTP binding protein-like 2 - deafness, autosomal dominant 5 - neurogenic differentiation 1 - H2A histone family, member Y2 |