Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NHEDC1-Na+/H+ exchanger domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NHEDC1-Na+/H+ exchanger domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022079 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NHEDC1 |
| Origin species: | Human |
| Product name: | NHEDC1-Na+/H+ exchanger domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC022079 |
| Gene id: | 150159 |
| Gene description: | Na+/H+ exchanger domain containing 1 |
| Synonyms: | NHEDC1; NHA1; sodium/hydrogen exchanger 9B1; NHE domain-containing protein 1; Na(+)/H(+) exchanger-like domain-containing protein 1; sodium/hydrogen exchanger-like domain-containing protein 1; solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1; solute carrier family 9, subfamily B (cation proton antiporter 2), member 1; testicular tissue protein Li 127; solute carrier family 9 member B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcttgagcatagtcttttcctcaggtgtggcctccgtctttcacccaggctggagtgtggtgtcacgatctcagctcactgcaaactctgcctcccgggttcaagtgattctcctccctcagcctcccgagtacctgggaccacaggtggtatacttaataacgccatagcctctataaggaacgtatgtattagtctgctggcaggaattgttttgggattttttgttcgatattttccaagtgaagaccagaaaaaacttacattgaagagaggattccttgttttgactatgtgtgtttctgccgtcttaggcagccaacgtattggtttacatggatctggaggattatgcacactagtgttgagtttcattgcagggacaaaatggtcccaagaaaagatgaaagtccaaaagattattacgactgtatgggatatttttcaaccacttctttttggtttagttggagcagaagtatctgtttcatcgcttgaatcaaatattgttggcatatctgttgccactctaagtttggcattatgtgttcgaattttaaccacatatctattgatgtgctttgctggttttagttttaaggagaaaatatttattgctttagcatggatgcccaaagctacagtacagagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GINS complex subunit 4 (Sld5 homolog) - secretory carrier membrane protein 4 - secretory carrier membrane protein 5 - secretory carrier membrane protein 3 |